[Go to site: main page, start]

100% found this document useful (1 vote)
335 views568 pages

Java Coding Interview Questions

This document contains a table of contents for a coding interview guide in Java. It lists 136 different coding problems organized by topic, with page numbers. Some example problems include "Remove Duplicates from Sorted Array", "Trapping Rain Water", "3Sum", "Longest Common Prefix", and "Linked List Cycle".

Uploaded by

Yasin KIZILKAYA
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
100% found this document useful (1 vote)
335 views568 pages

Java Coding Interview Questions

This document contains a table of contents for a coding interview guide in Java. It lists 136 different coding problems organized by topic, with page numbers. Some example problems include "Remove Duplicates from Sorted Array", "Trapping Rain Water", "3Sum", "Longest Common Prefix", and "Linked List Cycle".

Uploaded by

Yasin KIZILKAYA
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

Coding Interview in Java

Program Creek
Contents

1 Remove Duplicates from Sorted Array 14

2 Remove Duplicates from Sorted Array II 16

3 Remove Element 18

4 Move Zeroes 19

5 Candy 20

6 Trapping Rain Water 22

7 Product of Array Except Self 24

8 Minimum Size Subarray Sum 26

9 Summary Ranges 28

10 Missing Ranges 29

11 Merge Intervals 30

12 Insert Interval 31

13 Partition Labels 34

14 Find And Replace in String 36

15 One Edit Distance 37

16 Merge Sorted Array 38

17 Is Subsequence 40

18 Backspace String Compare 41

19 Repeated String Match 43

20 Container With Most Water 44

21 Reverse Vowels of a String 45

22 Valid Palindrome 46

23 Shortest Word Distance 47

24 Shortest Word Distance II 48

2 | 568
Contents

25 Shortest Word Distance III 50

26 Intersection of Two Arrays 52

27 Intersection of Two Arrays II 54

28 Two Sum II Input array is sorted 56

29 Two Sum III Data structure design 57

30 3Sum 58

31 4Sum 60

32 3Sum Closest 62

33 Wiggle Sort 63

34 Wiggle Subsequence 64

35 Longest Common Prefix 65

36 Next Permutation 66

37 Search Insert Position 68

38 Median of Two Sorted Arrays 70

39 Find Minimum in Rotated Sorted Array 72

40 Find Minimum in Rotated Sorted Array II 74

41 Find First and Last Position of Element in Sorted Array 76

42 Guess Number Higher or Lower 78

43 First Bad Version 80

44 Search in Rotated Sorted Array 82

45 Search in Rotated Sorted Array II 84

46 Longest Increasing Subsequence 85

47 Count of Smaller Numbers After Self 88

48 Russian Doll Envelopes 91

49 HIndex 93

50 HIndex II 95

51 Valid Anagram 96

52 Group Shifted Strings 98

53 Palindrome Pairs 100

54 Line Reflection 102

Program Creek 3 | 568


Contents

55 Isomorphic Strings 103

56 Two Sum 104

57 Maximum Size Subarray Sum Equals k 105

58 Subarray Sum Equals K 107

59 Maximum Subarray 108

60 Maximum Product Subarray 111

61 Longest Substring Without Repeating Characters 112

62 Longest Substring with At Most K Distinct Characters 114

63 Substring with Concatenation of All Words 116

64 Minimum Window Substring 118

65 Longest Substring with At Least K Repeating Characters 120

66 Permutation in String 122

67 Longest Consecutive Sequence 124

68 Majority Element 126

69 Majority Element II 128

70 Increasing Triplet Subsequence 129

71 Find the Second Largest Number in an Array 131

72 Word Ladder 132

73 Word Ladder II 134

74 Top K Frequent Elements 136

75 Meeting Rooms II 139

76 Meeting Rooms 141

77 Range Addition 142

78 Merge K Sorted Arrays in Java 144

79 Merge k Sorted Lists 146

80 Rearrange String k Distance Apart 147

81 Minimum Cost to Hire K Workers 149

82 Contains Duplicate 151

83 Contains Duplicate II 152

84 Contains Duplicate III 153

Program Creek 4 | 568


Contents

85 Max Sum of Rectangle No Larger Than K 155

86 Maximum Sum of Subarray Close to K 158

87 Sliding Window Maximum 160

88 Moving Average from Data Stream 162

89 Find Median from Data Stream 163

90 Data Stream as Disjoint Intervals 165

91 Linked List Random Node 167

92 Shuffle an Array 168

93 Sort List 170

94 Quicksort Array in Java 172

95 Kth Largest Element in an Array 175

96 Sort Colors 177

97 Maximum Gap 178

98 Group Anagrams 180

99 Ugly Number 181

100 Ugly Number II 182

101 Super Ugly Number 183

102 Find K Pairs with Smallest Sums 184

103 Rotate Array in Java 185

104 Reverse Words in a String II 188

105 Missing Number 189

106 Find the Duplicate Number 190

107 First Missing Positive 192

108 Queue Reconstruction by Height 194

109 Binary Watch 195

110 Search a 2D Matrix 198

111 Search a 2D Matrix II 199

112 Kth Smallest Element in a Sorted Matrix 201

113 Design Snake Game 203

114 Number of Islands II 205

Program Creek 5 | 568


Contents

115 Number of Connected Components in an Undirected Graph 207

116 Most Stones Removed with Same Row or Column 210

117 Longest Increasing Path in a Matrix 213

118 Word Search 216

119 Word Search II 219

120 Number of Islands 223

121 Find a Path in a Matrix 226

122 Sudoku Solver 228

123 Valid Sudoku 231

124 Walls and Gates 233

125 Surrounded Regions 236

126 Set Matrix Zeroes 240

127 Spiral Matrix 243

128 Spiral Matrix II 247

129 Rotate Image 249

130 Range Sum Query 2D Immutable 250

131 Shortest Distance from All Buildings 253

132 Best Meeting Point 255

133 Game of Life 256

134 TicTacToe 258

135 Sparse Matrix Multiplication 261

136 Add Two Numbers 263

137 Reorder List 265

138 Linked List Cycle 269

139 Copy List with Random Pointer 270

140 Merge Two Sorted Lists 272

141 Odd Even Linked List 274

142 Remove Duplicates from Sorted List 276

143 Remove Duplicates from Sorted List II 278

144 Partition List 279

Program Creek 6 | 568


Contents

145 Intersection of Two Linked Lists 280

146 Remove Linked List Elements 282

147 Swap Nodes in Pairs 283

148 Reverse Linked List 285

149 Reverse Linked List II 287

150 Reverse Double Linked List 289

151 Remove Nth Node From End of List 291

152 Palindrome Linked List 293

153 Delete Node in a Linked List 296

154 Reverse Nodes in kGroup 297

155 Plus One Linked List 300

156 Binary Tree Preorder Traversal 302

157 Binary Tree Inorder Traversal 303

158 Binary Tree Postorder Traversal 305

159 Binary Tree Level Order Traversal 308

160 Binary Tree Level Order Traversal II 310

161 Binary Tree Vertical Order Traversal 312

162 Invert Binary Tree 314

163 Kth Smallest Element in a BST 315

164 Binary Tree Longest Consecutive Sequence 317

165 Validate Binary Search Tree 319

166 Flatten Binary Tree to Linked List 321

167 Path Sum 323

168 Path Sum II 325

169 Construct Binary Tree from Inorder and Postorder Traversal 327

170 Construct Binary Tree from Preorder and Inorder Traversal 329

171 Convert Sorted Array to Binary Search Tree 331

172 Convert Sorted List to Binary Search Tree 332

173 Minimum Depth of Binary Tree 334

174 Binary Tree Maximum Path Sum 336

Program Creek 7 | 568


Contents

175 Balanced Binary Tree 337

176 Symmetric Tree 339

177 Binary Search Tree Iterator 340

178 Binary Tree Right Side View 342

179 Lowest Common Ancestor of a Binary Search Tree 344

180 Lowest Common Ancestor of a Binary Tree 345

181 Most Frequent Subtree Sum 347

182 Verify Preorder Serialization of a Binary Tree 349

183 Populating Next Right Pointers in Each Node 351

184 Populating Next Right Pointers in Each Node II 354

185 Unique Binary Search Trees 356

186 Unique Binary Search Trees II 358

187 Sum Root to Leaf Numbers 360

188 Count Complete Tree Nodes 362

189 Closest Binary Search Tree Value 365

190 Binary Tree Paths 367

191 Maximum Depth of Binary Tree 369

192 Recover Binary Search Tree 370

193 Same Tree 371

194 Serialize and Deserialize Binary Tree 372

195 Inorder Successor in BST 375

196 Inorder Successor in BST II 376

197 Find Leaves of Binary Tree 378

198 Largest BST Subtree 380

199 Implement Trie (Prefix Tree) 382

200 Add and Search Word Data structure design 386

201 Range Sum Query Mutable 390

202 The Skyline Problem 394

203 Implement Stack using Queues 396

204 Implement Queue using Stacks 398

Program Creek 8 | 568


Contents

205 Implement a Stack Using an Array in Java 399

206 Implement a Queue using an Array in Java 401

207 Evaluate Reverse Polish Notation 403

208 Valid Parentheses 406

209 Longest Valid Parentheses 407

210 Min Stack 408

211 Max Chunks To Make Sorted 410

212 Maximal Rectangle 411

213 Mini Parser 413

214 Flatten Nested List Iterator 415

215 Nested List Weight Sum 417

216 Nested List Weight Sum II 419

217 Decode String 421

218 Evaluate math expression with plus, minus and parentheses 423

219 Partition to K Equal Sum Subsets 425

220 Permutations 427

221 Permutations II 430

222 Permutation Sequence 432

223 Number of Squareful Arrays 434

224 Generate Parentheses 437

225 Combination Sum 439

226 Combination Sum II 441

227 Combination Sum III 442

228 Combination Sum IV 443

229 Wildcard Matching 444

230 Regular Expression Matching 445

231 Expressive Words 448

232 Get Target Number Using Number List and Arithmetic Operations 450

233 Flip Game 452

234 Flip Game II 453

Program Creek 9 | 568


Contents

235 Word Pattern 454

236 Word Pattern II 455

237 Scramble String 457

238 Remove Invalid Parentheses 458

239 Shortest Palindrome 460

240 Lexicographical Numbers 462

241 Combinations 464

242 Letter Combinations of a Phone Number 465

243 Restore IP Addresses 467

244 Factor Combinations 469

245 Subsets 470

246 Subsets II 472

247 Coin Change 474

248 Palindrome Partitioning 477

249 Palindrome Partitioning II 479

250 House Robber 480

251 House Robber II 482

252 House Robber III 483

253 Jump Game 484

254 Jump Game II 486

255 Best Time to Buy and Sell Stock 487

256 Best Time to Buy and Sell Stock II 488

257 Best Time to Buy and Sell Stock III 489

258 Best Time to Buy and Sell Stock IV 491

259 Dungeon Game 493

260 Decode Ways 494

261 Perfect Squares 495

262 Word Break 496

263 Word Break II 499

264 Minimum Window Subsequence 502

Program Creek 10 | 568


Contents

265 Maximal Square 503

266 Minimum Path Sum 505

267 Unique Paths 507

268 Unique Paths II 509

269 Paint House 511

270 Paint House II 513

271 Edit Distance in Java 515

272 Distinct Subsequences Total 518

273 Longest Palindromic Substring 520

274 Longest Common Subsequence 522

275 Longest Common Substring 524

276 LRU Cache 526

277 Insert Delete GetRandom O(1) 529

278 Insert Delete GetRandom O(1) Duplicates allowed 531

279 Design a Data Structure with Insert, Delete and GetMostFrequent of O(1) 533

280 Design Phone Directory 536

281 Design Twitter 537

282 Single Number 540

283 Single Number II 541

284 Twitter Codility Problem Max Binary Gap 542

285 Number of 1 Bits 544

286 Reverse Bits 545

287 Repeated DNA Sequences 546

288 Bitwise AND of Numbers Range 548

289 Sum of Two Integers 549

290 Counting Bits 550

291 Maximum Product of Word Lengths 552

292 Gray Code 553

293 UTF8 Validation 554

294 Course Schedule 555

Program Creek 11 | 568


Contents

295 Course Schedule II 558

296 Minimum Height Trees 560

297 Graph Valid Tree 562

298 Clone Graph 564

299 Reconstruct Itinerary 567

300 Pow(x, n) 568

Program Creek 12 | 568


Contents

Every title in the PDF is linked back to the original blog. When it is clicked, it opens the original post in your
browser. If you want to discuss any problem, please go to the post and leave your comment there.
I’m not an expert and some solutions may not be optimal. So please leave your comment if you see any problem
or have a better solution. I will reply your comment as soon as I can.
This collection is updated from time to time. Please check out this link for the latest version: [Link]
10-algorithms-for-coding-interview/

Program Creek 13 | 568


1 Remove Duplicates from Sorted Array
Given a sorted array, remove the duplicates in place such that each element appear only once and return the new
length. Do not allocate extra space for another array, you must do this in place with constant memory.
For example, given input array A = [1,1,2], your function should return length = 2, and A is now [1,2].

1.1 Analysis
The problem is pretty straightforward. It returns the length of the array with unique elements, but the original
array need to be changed also. This problem is similar to Remove Duplicates from Sorted Array II.

1.2 Java Solution

public static int removeDuplicates(int[] A) {


if ([Link] < 2)
return [Link];

int j = 0;
int i = 1;

while (i < [Link]) {


if (A[i] != A[j]) {
j++;
A[j] = A[i];
}

i++;
}

return j + 1;
}

14 | 568
1 Remove Duplicates from Sorted Array

Note that we only care about the first unique part of the original array. So it is ok if input array is 1, 2, 2, 3, 3,
the array is changed to 1, 2, 3, 3, 3.

Program Creek 15 | 568


2 Remove Duplicates from Sorted Array II
Follow up for "Remove Duplicates": What if duplicates are allowed at most twice?
For example, given sorted array A = [1,1,1,2,2,3], your function should return length = 5, and A is now [1,1,2,2,3].
So this problem also requires in-place array manipulation.

2.1 Java Solution 1


We can not change the given array’s size, so we only change the first k elements of the array which has duplicates
removed.

public int removeDuplicates(int[] nums) {


if(nums==null){
return 0;
}
if([Link]<3){
return [Link];
}

int i=0;
int j=1;
/*

i, j 1 1 1 2 2 3
step1 0 1 i j
step2 1 2 i j
step3 1 3 i j
step4 2 4 i j

*/
while(j<[Link]){
if(nums[j]==nums[i]){
if(i==0){
i++;
j++;
}else if(nums[i]==nums[i-1]){
j++;
}else{
i++;
nums[i]=nums[j];
j++;
}
}else{
i++;
nums[i]=nums[j];
j++;
}
}

return i+1;
}

16 | 568
2 Remove Duplicates from Sorted Array II

The problem with this solution is that there are 4 cases to handle. If we shift our two points to right by 1
element, the solution can be simplified as the Solution 2.

2.2 Java Solution 2

public int removeDuplicates(int[] nums) {


if(nums==null){
return 0;
}

if ([Link] <= 2){


return [Link];
}
/*
1,1,1,2,2,3
i j
*/
int i = 1; // point to previous
int j = 2; // point to current

while (j < [Link]) {


if (nums[j] == nums[i] && nums[j] == nums[i - 1]) {
j++;
} else {
i++;
nums[i] = nums[j];
j++;
}
}

return i + 1;
}

Program Creek 17 | 568


3 Remove Element
Given an array and a value, remove all instances of that value in place and return the new length. (Note: The
order of elements can be changed. It doesn’t matter what you leave beyond the new length.)

3.1 Java Solution


This problem can be solve by using two indices.

public int removeElement(int[] A, int elem) {


int i=0;
int j=0;

while(j < [Link]){


if(A[j] != elem){
A[i] = A[j];
i++;
}

j++;
}

return i;
}

18 | 568
4 Move Zeroes
Given an array nums, write a function to move all 0’s to the end of it while maintaining the relative order of the
non-zero elements.
For example, given nums = [0, 1, 0, 3, 12], after calling your function, nums should be [1, 3, 12, 0, 0].

4.1 Java Solution 2


We can use the similar code that is used to solve Remove Duplicates from Sorted Array I, II, Remove Element.

public void moveZeroes(int[] nums) {


int i=0;
int j=0;

while(j<[Link]){
if(nums[j]==0){
j++;
}else{
nums[i]=nums[j];
i++;
j++;
}
}

while(i<[Link]){
nums[i]=0;
i++;
}
}

19 | 568
5 Candy
There are N children standing in a line. Each child is assigned a rating value. You are giving candies to these
children subjected to the following requirements:
1. Each child must have at least one candy. 2. Children with a higher rating get more candies than their
neighbors.
What is the minimum candies you must give?

5.1 Analysis
This problem can be solved in O(n) time.
We can always assign a neighbor with 1 more if the neighbor has higher a rating value. However, to get the
minimum total number, we should always start adding 1s in the ascending order. We can solve this problem by
scanning the array from both sides. First, scan the array from left to right, and assign values for all the ascending
pairs. Then scan from right to left and assign values to descending pairs.
This problem is similar to Trapping Rain Water.

5.2 Java Solution

public int candy(int[] ratings) {


if (ratings == null || [Link] == 0) {
return 0;
}

int[] candies = new int[[Link]];


candies[0] = 1;

//from let to right


for (int i = 1; i < [Link]; i++) {
if (ratings[i] > ratings[i - 1]) {
candies[i] = candies[i - 1] + 1;
} else {
// if not ascending, assign 1
candies[i] = 1;
}
}

int result = candies[[Link] - 1];

//from right to left


for (int i = [Link] - 2; i >= 0; i--) {
int cur = 1;
if (ratings[i] > ratings[i + 1]) {
cur = candies[i + 1] + 1;
}

result += [Link](cur, candies[i]);


candies[i] = cur;
}

20 | 568
5 Candy

return result;
}

Program Creek 21 | 568


6 Trapping Rain Water
Given n non-negative integers representing an elevation map where the width of each bar is 1, compute how
much water it is able to trap after raining.
For example, given [0,1,0,2,1,0,1,3,2,1,2,1], return 6.

6.1 Analysis
This problem is similar to Candy. It can be solve by scanning from both sides and then get the total.

6.2 Java Solution

public int trap(int[] height) {


int result = 0;

if(height==null || [Link]<=2)
return result;

int left[] = new int[[Link]];


int right[]= new int[[Link]];

//scan from left to right


int max = height[0];
left[0] = height[0];
for(int i=1; i<[Link]; i++){
if(height[i]<max){
left[i]=max;

22 | 568
6 Trapping Rain Water

}else{
left[i]=height[i];
max = height[i];
}
}

//scan from right to left


max = height[[Link]-1];
right[[Link]-1]=height[[Link]-1];
for(int i=[Link]-2; i>=0; i--){
if(height[i]<max){
right[i]=max;
}else{
right[i]=height[i];
max = height[i];
}
}

//calculate totoal
for(int i=0; i<[Link]; i++){
result+= [Link](left[i],right[i])-height[i];
}

return result;
}

Program Creek 23 | 568


7 Product of Array Except Self
Given an array of n integers where n >1, nums, return an array output such that output[i] is equal to the product
of all the elements of nums except nums[i].
Solve it without division and in O(n).
For example, given [1,2,3,4], return [24,12,8,6].

7.1 Java Solution 1

public int[] productExceptSelf(int[] nums) {


int[] result = new int[[Link]];

int[] t1 = new int[[Link]];


int[] t2 = new int[[Link]];

t1[0]=1;
t2[[Link]-1]=1;

//scan from left to right


for(int i=0; i<[Link]-1; i++){
t1[i+1] = nums[i] * t1[i];
}

//scan from right to left


for(int i=[Link]-1; i>0; i--){
t2[i-1] = t2[i] * nums[i];
}

//multiply
for(int i=0; i<[Link]; i++){
result[i] = t1[i] * t2[i];
}

return result;
}

7.2 Java Solution 2


We can directly put the product values into the final result array. This saves the extra space to store the 2
intermediate arrays in Solution 1.

public int[] productExceptSelf(int[] nums) {


int[] result = new int[[Link]];

result[[Link]-1]=1;
for(int i=[Link]-2; i>=0; i--){
result[i]=result[i+1]*nums[i+1];
}

24 | 568
7 Product of Array Except Self

int left=1;
for(int i=0; i<[Link]; i++){
result[i]=result[i]*left;
left = left*nums[i];
}

return result;
}

Program Creek 25 | 568


8 Minimum Size Subarray Sum
Given an array of n positive integers and a positive integer s, find the minimal length of a subarray of which the
sum ≥ s. If there isn’t one, return 0 instead.
For example, given the array [2,3,1,2,4,3] and s = 7, the subarray [4,3] has the minimal length of 2 under the
problem constraint.

8.1 Analysis
We can use 2 points to mark the left and right boundaries of the sliding window. When the sum is greater than
the target, shift the left pointer; when the sum is less than the target, shift the right pointer.

8.2 Java Solution - two pointers


A simple sliding window solution.

public int minSubArrayLen(int s, int[] nums) {


if(nums==null || [Link]==1)
return 0;

int result = [Link];

int start=0;
int sum=0;
int i=0;
boolean exists = false;

while(i<=[Link]){
if(sum>=s){
exists=true; //mark if there exists such a subarray
if(start==i-1){
return 1;
}

result = [Link](result, i-start);


sum=sum-nums[start];
start++;

}else{
if(i==[Link])
break;
sum = sum+nums[i];
i++;
}
}

if(exists)
return result;
else
return 0;

26 | 568
8 Minimum Size Subarray Sum

Similarly, we can also write it in a more readable way.

public int minSubArrayLen(int s, int[] nums) {


if(nums==null||[Link]==0)
return 0;

int i=0;
int j=0;
int sum=0;

int minLen = Integer.MAX_VALUE;

while(j<[Link]){
if(sum<s){
sum += nums[j];
j++;
}else{
minLen = [Link](minLen, j-i);
if(i==j-1)
return 1;

sum -=nums[i];
i++;
}
}

while(sum>=s){
minLen = [Link](minLen, j-i);

sum -=nums[i++];
}

return minLen==Integer.MAX_VALUE? 0: minLen;


}

Program Creek 27 | 568


9 Summary Ranges
Given a sorted integer array without duplicates, return the summary of its ranges for consecutive numbers.
For example, given [0,1,2,4,5,7], return ["0->2","4->5","7"].

9.1 Analysis
When iterating over the array, two values need to be tracked: 1) the first value of a new range and 2) the previous
value in the range.

9.2 Java Solution

public List<String> summaryRanges(int[] nums) {


List<String> result = new ArrayList<String>();

if(nums == null || [Link]==0)


return result;

if([Link]==1){
[Link](nums[0]+"");
}

int pre = nums[0]; // previous element


int first = pre; // first element of each range

for(int i=1; i<[Link]; i++){


if(nums[i]==pre+1){
if(i==[Link]-1){
[Link](first+"->"+nums[i]);
}
}else{
if(first == pre){
[Link](first+"");
}else{
[Link](first + "->"+pre);
}

if(i==[Link]-1){
[Link](nums[i]+"");
}

first = nums[i];
}

pre = nums[i];
}

return result;
}

28 | 568
10 Missing Ranges
Given a sorted integer array nums, where the range of elements are in the inclusive range [lower, upper], return
its missing ranges.
Example:
Input: nums = [0, 1, 3, 50, 75], lower = 0 and upper = 99, Output: ["2", "4->49", "51->74", "76->99"]

10.1 Java Solution

public List<String> findMissingRanges(int[] nums, int lower, int upper) {


List<String> result = new ArrayList<>();
int start = lower;

if(lower==Integer.MAX_VALUE){
return result;
}

for(int i=0; i<[Link]; i++){


//handle duplicates, e.g., [1,1,1] lower=1 upper=1
if(i<[Link]-1 && nums[i]==nums[i+1]){
continue;
}

if(nums[i] == start){
start++;
}else{
[Link](getRange(start, nums[i]-1));
if(nums[i]==Integer.MAX_VALUE){
return result;
}
start = nums[i]+1;
}
}

if(start<=upper){
[Link](getRange(start, upper));
}

return result;
}

private String getRange(int n1, int n2) {


return n1 == n2 ? [Link](n1) : [Link]("%d->%d" , n1, n2);
}

29 | 568
11 Merge Intervals
Given a collection of intervals, merge all overlapping intervals.
For example, Given [1,3],[2,6],[8,10],[15,18], return [1,6],[8,10],[15,18].

11.1 Analysis
The key to solve this problem is defining a Comparator first to sort the arraylist of Intevals.

11.2 Java Solution

public List<Interval> merge(List<Interval> intervals) {


if(intervals == null || [Link]()<=1){
return intervals;
}

[Link](intervals, [Link]((Interval itl)->[Link]));

List<Interval> result = new ArrayList<>();


Interval t = [Link](0);

for(int i=1; i<[Link](); i++){


Interval c = [Link](i);
if([Link] <= [Link]){
[Link] = [Link]([Link], [Link]);
}else{
[Link](t);
t = c;
}
}

[Link](t);

return result;
}

30 | 568
12 Insert Interval
Problem:
Given a set of non-overlapping & sorted intervals, insert a new interval into the intervals (merge if necessary).

Example 1:
Given intervals [1,3],[6,9], insert and merge [2,5] in as [1,5],[6,9].

Example 2:
Given [1,2],[3,5],[6,7],[8,10],[12,16], insert and merge [4,9] in as [1,2],[3,10],[12,16].

This is because the new interval [4,9] overlaps with [3,5],[6,7],[8,10].

12.1 Java Solution 1


When iterating over the list, there are three cases for the current range.

/**
* Definition for an interval.
* public class Interval {
* int start;
* int end;
* Interval() { start = 0; end = 0; }
* Interval(int s, int e) { start = s; end = e; }

31 | 568
12 Insert Interval

* }
*/
public class Solution {
public ArrayList<Interval> insert(ArrayList<Interval> intervals, Interval newInterval) {

ArrayList<Interval> result = new ArrayList<Interval>();

for(Interval interval: intervals){


if([Link] < [Link]){
[Link](interval);
}else if([Link] > [Link]){
[Link](newInterval);
newInterval = interval;
}else if([Link] >= [Link] || [Link] <= [Link]){
newInterval = new Interval([Link]([Link], [Link]),
[Link]([Link], [Link]));
}
}

[Link](newInterval);

return result;
}
}

12.2 Java Solution 2 - Binary Search


If the intervals list is an ArrayList, we can use binary search to make the best search time complexity O(log(n)).
However, the worst time is bounded by shifting the array list if a new range needs to be inserted. So time
complexity is still O(n).

public List<Interval> insert(List<Interval> intervals, Interval newInterval) {


List<Interval> result = new ArrayList<>();

if ([Link]() == 0) {
[Link](newInterval);
return result;
}

int p = helper(intervals, newInterval);


[Link]([Link](0, p));

for (int i = p; i < [Link](); i++) {


Interval interval = [Link](i);
if ([Link] < [Link]) {
[Link](interval);
} else if ([Link] > [Link]) {
[Link](newInterval);
newInterval = interval;
} else if ([Link] >= [Link] || [Link] <= [Link]) {
newInterval = new Interval([Link]([Link], [Link]),
[Link]([Link], [Link]));
}
}

[Link](newInterval);

Program Creek 32 | 568


12 Insert Interval

return result;
}

public int helper(List<Interval> intervals, Interval newInterval) {


int low = 0;
int high = [Link]() - 1;

while (low < high) {


int mid = low + (high - low) / 2;

if ([Link] <= [Link](mid).start) {


high = mid;
} else {
low = mid + 1;
}
}

return high == 0 ? 0 : high - 1;


}

The best time is O(log(n)) and worst case time is O(n).

Program Creek 33 | 568


13 Partition Labels
A string S of lowercase letters is given. We want to partition this string into as many parts as possible so that each
letter appears in at most one part, and return a list of integers representing the size of these parts.
For example:
Input: S = "ababfeefhijkh" Output: [4,4,5]
Explanation: The partition is "abab", "feef", "hijkh". This is a partition so that each letter appears in at most one
part.

13.1 Java Solution

public List<Integer> partitionLabels(String S) {


ArrayList<Integer> result = new ArrayList<>();

HashMap<Character, int[]> map = new HashMap<>();


for(int i=0; i<[Link](); i++){
char c = [Link](i);
int[] arr = [Link](c);

if(arr == null){
arr = new int[]{i, i};
[Link](c, arr);
}else{
arr[1]=i;
}
}

ArrayList<int[]> list = new ArrayList<>();


[Link]([Link]());

[Link](list, [Link]((int[] arr) -> arr[0]));

34 | 568
13 Partition Labels

int[] t = [Link](0);
for(int i=1; i<[Link](); i++){
int[] range = [Link](i);

if(range[1]<=t[1]){
continue;
}else if(range[0]>t[1]){ //impossible be equal
[Link](t[1]-t[0]+1);
t = range;
}else{
t[1] = range[1];
}
}

[Link](t[1]-t[0]+1);

return result;
}

Program Creek 35 | 568


14 Find And Replace in String
To some string S, we will perform some replacement operations that replace groups of letters with new ones (not
necessarily the same size).
Each replacement operation has 3 parameters: a starting index i, a source word x and a target word y. The rule
is that if x starts at position i in the original string S, then we will replace that occurrence of x with y. If not, we
do nothing.
For example, if we have S = "abcd" and we have some replacement operation i = 2, x = "cd", y = "ffff", then
because "cd" starts at position 2 in the original string S, we will replace it with "ffff".

14.1 Java Solution

public String findReplaceString(String S, int[] indexes, String[] sources, String[] targets) {


StringBuilder sb = new StringBuilder();
TreeMap<Integer, String[]> map = new TreeMap<>();
for (int i = 0; i < [Link]; i++) {
[Link](indexes[i], new String[]{sources[i], targets[i]});
}

int prev = 0;

for ([Link]<Integer, String[]> entry : [Link]()) {


int startIndex = [Link]();
int endIndex = startIndex + [Link]()[0].length();

if (prev != startIndex) {
[Link]([Link](prev, startIndex));
}

String org = [Link](startIndex, endIndex);


if ([Link]([Link]()[0])) {
[Link]([Link]()[1]);
prev = endIndex;
} else {
[Link](org);
prev = endIndex;
}

if (prev < [Link]()) {


[Link]([Link](prev));
}

return [Link]();
}

36 | 568
15 One Edit Distance
Given two strings S and T, determine if they are both one edit distance apart.

15.1 Java Solution

public boolean isOneEditDistance(String s, String t) {


if(s==null || t==null)
return false;

int m = [Link]();
int n = [Link]();

if([Link](m-n)>1){
return false;
}

int i=0;
int j=0;
int count=0;

while(i<m&&j<n){
if([Link](i)==[Link](j)){
i++;
j++;
}else{
count++;
if(count>1)
return false;

if(m>n){
i++;
}else if(m<n){
j++;
}else{
i++;
j++;
}
}
}

if(i<m||j<n){
count++;
}

if(count==1)
return true;

return false;
}

37 | 568
16 Merge Sorted Array
Given two sorted integer arrays A and B, merge B into A as one sorted array.
Note: You may assume that A has enough space to hold additional elements from B. The number of elements
initialized in A and B are m and n respectively.

16.1 Analysis
The key to solve this problem is moving element of A and B backwards. If B has some elements left after A is
done, also need to handle that case.
The takeaway message from this problem is that the loop condition. This kind of condition is also used for
merging two sorted linked list.

16.2 Java Solution 1

public class Solution {


public void merge(int A[], int m, int B[], int n) {

while(m > 0 && n > 0){


if(A[m-1] > B[n-1]){
A[m+n-1] = A[m-1];
m--;
}else{
A[m+n-1] = B[n-1];
n--;
}
}

while(n > 0){


A[m+n-1] = B[n-1];
n--;
}
}
}

16.3 Java Solution 2


The loop condition also can use m+n like the following.

public void merge(int A[], int m, int B[], int n) {


int i = m - 1;
int j = n - 1;
int k = m + n - 1;

while (k >= 0) {
if (j < 0 || (i >= 0 && A[i] > B[j]))
A[k--] = A[i--];

38 | 568
16 Merge Sorted Array

else
A[k--] = B[j--];
}
}

Program Creek 39 | 568


17 Is Subsequence
Given a string s and a string t, check if s is subsequence of t.
You may assume that there is only lower case English letters in both s and t. t is potentially a very long (length
= 500,000) string, and s is a short string (<=100).
A subsequence of a string is a new string which is formed from the original string by deleting some (can
be none) of the characters without disturbing the relative positions of the remaining characters. (ie, "ace" is a
subsequence of "abcde" while "aec" is not).

17.1 Java Solution

public boolean isSubsequence(String s, String t) {


if([Link]()==0)
return true;

int i=0;
int j=0;
while(i<[Link]() && j<[Link]()){
if([Link](i)==[Link](j)){
i++;
}

j++;

if(i==[Link]())
return true;
}

return false;
}

40 | 568
18 Backspace String Compare
Given two strings S and T, return if they are equal when both are typed into empty text editors. # means a
backspace character.
Example 1:

Input: S = "ab#c", T = "ad#c"


Output: true
Explanation: Both S and T become "ac".

Example 2:

Input: S = "a##c", T = "#a#c"


Output: true
Explanation: Both S and T become "c".

18.1 Java Solution


This problem requires O(N) time and O(1) space.

public boolean backspaceCompare(String S, String T) {


int i = [Link]()-1;
int j = [Link]()-1;

while(i>=0 || j>=0){
int c1=0;
while(i>=0 && (c1>0 || [Link](i)==’#’)){
if([Link](i)==’#’){
c1++;
}else{
c1--;
}

i--;
}

int c2=0;
while(j>=0 && (c2>0 || [Link](j)==’#’)){
if([Link](j)==’#’){
c2++;
}else{
c2--;
}

j--;
}

if(i>=0 && j>=0){


if([Link](i)!=[Link](j)){
return false;

41 | 568
18 Backspace String Compare

}else{
i--;
j--;
}
}else{
if(i>=0 || j>=0){
return false;
}
}
}

return i<0 && j<0;


}

Program Creek 42 | 568


19 Repeated String Match
Given two strings A and B, find the minimum number of times A has to be repeated such that B is a substring of
it. If no such solution, return -1.
For example, with A = "abcd" and B = "cdabcdab".
Return 3, because by repeating A three times (“abcdabcdabcd”), B is a substring of it; and B is not a substring
of A repeated two times ("abcdabcd").
Note: The length of A and B will be between 1 and 10000.

19.1 Java Solution


The optimal solution’s time complexity is O(n) where n is the length of the longer string from A and B.

public int repeatedStringMatch(String A, String B) {


int i = 0;
int j = 0;

int result = 0;
int k = 0;

while (j < [Link]()) {


if ([Link](i) == [Link](j)) {
i++;
j++;

if (i == [Link]()) {
i = 0;
result++;
}
} else {
k++;
if (k == [Link]()) {
return -1;
}
i = k;
j = 0;
result = 0;
}
}

if (i > 0) {
result++;
}

return result;
}

43 | 568
20 Container With Most Water

20.1 Problem
Given n non-negative integers a1, a2, ..., an, where each represents a point at coordinate (i, ai). n vertical lines are
drawn such that the two endpoints of line i is at (i, ai) and (i, 0). Find two lines, which together with x-axis forms
a container, such that the container contains the most water.

20.2 Analysis
Initially we can assume the result is 0. Then we scan from both sides. If leftHeight <rightHeight, move right and
find a value that is greater than leftHeight. Similarily, if leftHeight >rightHeight, move left and find a value that
is greater than rightHeight. Additionally, keep tracking the max value.

20.3 Java Solution

public int maxArea(int[] height) {


if (height == null || [Link] < 2) {
return 0;
}

int max = 0;
int left = 0;
int right = [Link] - 1;

while (left < right) {


max = [Link](max, (right - left) * [Link](height[left], height[right]));
if (height[left] < height[right])
left++;
else
right--;
}

return max;
}

44 | 568
21 Reverse Vowels of a String
Write a function that takes a string as input and reverse only the vowels of a string.

21.1 Java Solution


this is a simple problem which can be solved by using two pointers scanning from beginning and end of the array.

public String reverseVowels(String s) {


ArrayList<Character> vowList = new ArrayList<Character>();
[Link](’a’);
[Link](’e’);
[Link](’i’);
[Link](’o’);
[Link](’u’);
[Link](’A’);
[Link](’E’);
[Link](’I’);
[Link](’O’);
[Link](’U’);

char[] arr = [Link]();

int i=0;
int j=[Link]()-1;

while(i<j){
if(![Link](arr[i])){
i++;
continue;
}

if(![Link](arr[j])){
j--;
continue;
}

char t = arr[i];
arr[i]=arr[j];
arr[j]=t;

i++;
j--;
}

return new String(arr);


}

45 | 568
22 Valid Palindrome
Given a string, determine if it is a palindrome, considering only alphanumeric characters and ignoring cases.
For example, "Red rum, sir, is murder" is a palindrome, while "Programcreek is awesome" is not.
Note: Have you consider that the string might be empty? This is a good question to ask during an interview.
For the purpose of this problem, we define empty string as valid palindrome.

22.1 Java Solution


There are several different ways to solve this problem. The following is a solution with O(n) time complexity and
O(1) space complexity.

public boolean isPalindrome(String s) {


if(s==null){
return false;
}

s = [Link]();

int i=0;
int j=[Link]()-1;

while(i<j){
while(i<j && !(([Link](i)>=’a’ && [Link](i)<=’z’)
|| ([Link](i)>=’0’&&[Link](i)<=’9’))){
i++;
}

while(i<j && !(([Link](j)>=’a’ && [Link](j)<=’z’)


|| ([Link](j)>=’0’&&[Link](j)<=’9’))){
j--;
}

if([Link](i) != [Link](j)){
return false;
}

i++;
j--;
}

return true;
}

46 | 568
23 Shortest Word Distance
Given a list of words and two words word1 and word2, return the shortest distance between these two words in
the list.
For example, Assume that words = ["practice", "makes", "perfect", "coding", "makes"].
Given word1 = “coding”, word2 = “practice”, return 3. Given word1 = "makes", word2 = "coding", return 1.

23.1 Java Solution

public int shortestDistance(String[] words, String word1, String word2) {


int m=-1;
int n=-1;

int min = Integer.MAX_VALUE;

for(int i=0; i<[Link]; i++){


String s = words[i];
if([Link](s)){
m = i;
if(n!=-1)
min = [Link](min, m-n);
}else if([Link](s)){
n = i;
if(m!=-1)
min = [Link](min, n-m);
}
}

return min;
}

47 | 568
24 Shortest Word Distance II
This is a follow up of Shortest Word Distance. The only difference is now you are given the list of words and
your method will be called repeatedly many times with different parameters. How would you optimize it?
Design a class which receives a list of words in the constructor, and implements a method that takes two words
word1 and word2 and return the shortest distance between these two words in the list.
For example, Assume that words = ["practice", "makes", "perfect", "coding", "makes"].
Given word1 = “coding”, word2 = “practice”, return 3. Given word1 = "makes", word2 = "coding", return 1.

24.1 Java Solution

public class WordDistance {


HashMap<String, ArrayList<Integer>> map;
public WordDistance(String[] words) {
map = new HashMap<String, ArrayList<Integer>>();
for(int i=0; i<[Link]; i++){
if([Link](words[i])){
[Link](words[i]).add(i);
}else{
ArrayList<Integer> list = new ArrayList<Integer>();
[Link](i);
[Link](words[i], list);
}
}
}

public int shortest(String word1, String word2) {

ArrayList<Integer> l1 = [Link](word1);
ArrayList<Integer> l2 = [Link](word2);

int result = Integer.MAX_VALUE;


for(int i1: l1){
for(int i2: l2){
result = [Link](result, [Link](i1-i2));
}
}
return result;
}
}

The time complexity for shortest method is O(M*N), where M is freqency of word1 and N is the frequency of
word2. This can be improved by the following:

public int shortest(String word1, String word2) {

ArrayList<Integer> l1 = [Link](word1);
ArrayList<Integer> l2 = [Link](word2);

int result = Integer.MAX_VALUE;

48 | 568
24 Shortest Word Distance II

int i=0;
int j=0;
while(i<[Link]() && j<[Link]()){
result = [Link](result, [Link]([Link](i)-[Link](j)));
if([Link](i)<[Link](j)){
i++;
}else{
j++;
}
}

return result;
}

The time complexity of the shortest method is now O(M+N). Since M+N <size of word list, the time is O(K)
where k is the list size.

Program Creek 49 | 568


25 Shortest Word Distance III
This is a follow-up problem of Shortest Word Distance. The only difference is now word1 could be the same as
word2.
Given a list of words and two words word1 and word2, return the shortest distance between these two words
in the list.
word1 and word2 may be the same and they represent two individual words in the list.
For example, Assume that words = ["practice", "makes", "perfect", "coding", "makes"].
Given word1 = “makes”, word2 = “coding”, return 1. Given word1 = "makes", word2 = "makes", return 3.

25.1 Java Solution 1


In this problem, word1 and word2 can be the same. The two variables used to track indices should take turns to
update.

public int shortestWordDistance(String[] words, String word1, String word2) {


if(words==null || [Link]<1 || word1==null || word2==null)
return 0;

int m=-1;
int n=-1;

int min = Integer.MAX_VALUE;


int turn=0;
if([Link](word2))
turn = 1;

for(int i=0; i<[Link]; i++){


String s = words[i];
if([Link](s) && (turn ==1 || turn==0)){
m = i;
if(turn==1) turn=2;
if(n!=-1)
min = [Link](min, m-n);
}else if([Link](s) && (turn==2 || turn==0)){
n = i;
if(turn==2) turn =1;
if(m!=-1)
min = [Link](min, n-m);
}
}

return min;
}

25.2 Java Solution 2


We can divide the cases to two: word1 and word2 are the same and not the same.

50 | 568
25 Shortest Word Distance III

public int shortestWordDistance(String[] words, String word1, String word2) {


if(words==null||[Link]==0)
return -1;

if(word1==null || word2==null)
return -1;

boolean isSame = false;

if([Link](word2))
isSame = true;

int shortest= Integer.MAX_VALUE;

int prev=-1;
int i1=-1;
int i2=-1;

for(int i=0; i<[Link]; i++){


if(isSame){
if(words[i].equals(word1)){
if(prev!=-1){
shortest=[Link](shortest, i-prev);
}
prev = i;
}
}else{
if([Link](words[i])){
i1=i;
if(i2!=-1){
shortest = [Link](shortest, i-i2);
}
}else if([Link](words[i])){
i2=i;
if(i1!=-1){
shortest = [Link](shortest, i-i1);
}
}
}
}

return shortest;
}

Program Creek 51 | 568


26 Intersection of Two Arrays
Given two arrays, write a function to compute their intersection.

26.1 Java Solution 1 - HashSet


Time = O(n). Space = O(n).

public int[] intersection(int[] nums1, int[] nums2) {


HashSet<Integer> set1 = new HashSet<Integer>();
for(int i: nums1){
[Link](i);
}

HashSet<Integer> set2 = new HashSet<Integer>();


for(int i: nums2){
if([Link](i)){
[Link](i);
}
}

int[] result = new int[[Link]()];


int i=0;
for(int n: set2){
result[i++] = n;
}

return result;
}

26.2 Java Solution 2 - Binary Search


Time = O(nlog(n)). Space = O(n).

public int[] intersection(int[] nums1, int[] nums2) {


[Link](nums1);
[Link](nums2);

ArrayList<Integer> list = new ArrayList<Integer>();


for(int i=0; i<[Link]; i++){
if(i==0 || (i>0 && nums1[i]!=nums1[i-1])){
if([Link](nums2, nums1[i])>-1){
[Link](nums1[i]);
}
}
}

int[] result = new int[[Link]()];


int k=0;

52 | 568
26 Intersection of Two Arrays

for(int i: list){
result[k++] = i;
}

return result;
}

26.3 Any improvement?

Program Creek 53 | 568


27 Intersection of Two Arrays II
Given two arrays, write a function to compute their intersection.
Example: Given nums1 = [1, 2, 2, 1], nums2 = [2, 2], return [2, 2].

27.1 Java Solution 1

public int[] intersect(int[] nums1, int[] nums2) {


HashMap<Integer, Integer> map = new HashMap<Integer, Integer>();
for(int i: nums1){
if([Link](i)){
[Link](i, [Link](i)+1);
}else{
[Link](i, 1);
}
}

ArrayList<Integer> list = new ArrayList<Integer>();


for(int i: nums2){
if([Link](i)){
if([Link](i)>1){
[Link](i, [Link](i)-1);
}else{
[Link](i);
}
[Link](i);
}
}

int[] result = new int[[Link]()];


int i =0;
while(i<[Link]()){
result[i]=[Link](i);
i++;
}

return result;
}

27.2 Java Solution 2


If the arrays are sorted, then we can use two points.

public int[] intersect(int[] nums1, int[] nums2) {


[Link](nums1);
[Link](nums2);
ArrayList<Integer> list = new ArrayList<Integer>();
int p1=0, p2=0;

54 | 568
27 Intersection of Two Arrays II

while(p1<[Link] && p2<[Link]){


if(nums1[p1]<nums2[p2]){
p1++;
}else if(nums1[p1]>nums2[p2]){
p2++;
}else{
[Link](nums1[p1]);
p1++;
p2++;

}
}

int[] result = new int[[Link]()];


int i=0;
while(i<[Link]()){
result[i]=[Link](i);
i++;
}
return result;
}

Program Creek 55 | 568


28 Two Sum II Input array is sorted
This problem is similar to Two Sum.
To solve this problem, we can use two pointers to scan the array from both sides. See Java solution below:

public int[] twoSum(int[] numbers, int target) {


if (numbers == null || [Link] == 0)
return null;

int i = 0;
int j = [Link] - 1;

while (i < j) {
int x = numbers[i] + numbers[j];
if (x < target) {
++i;
} else if (x > target) {
j--;
} else {
return new int[] { i + 1, j + 1 };
}
}

return null;
}

56 | 568
29 Two Sum III Data structure design
Design and implement a TwoSum class. It should support the following operations: add and find.
add - Add the number to an internal data structure. find - Find if there exists any pair of numbers which sum
is equal to the value.
For example,

add(1);
add(3);
add(5);
find(4) -> true
find(7) -> false

29.1 Java Solution


Since the desired class need add and get operations, HashMap is a good option for this purpose.

public class TwoSum {


private HashMap<Integer, Integer> elements = new HashMap<Integer, Integer>();

public void add(int number) {


if ([Link](number)) {
[Link](number, [Link](number) + 1);
} else {
[Link](number, 1);
}
}

public boolean find(int value) {


for (Integer i : [Link]()) {
int target = value - i;
if ([Link](target)) {
if (i == target && [Link](target) < 2) {
continue;
}
return true;
}
}
return false;
}
}

57 | 568
30 3Sum
Problem:
Given an array S of n integers, are there elements a, b, c in S such that a + b + c = 0? Find all unique triplets in the
array which gives the sum of zero.
Note: Elements in a triplet (a,b,c) must be in non-descending order. (ie, a ≤ b ≤ c) The solution set must not
contain duplicate triplets.

For example, given array S = {-1 0 1 2 -1 -4},

A solution set is:


(-1, 0, 1)
(-1, -1, 2)

30.1 Java Solution


This problem can be solved by using two pointers. Time complexity is O(n2̂).
To avoid duplicate, we can take advantage of sorted arrays, i.e., move pointers by >1 to use same element only
once.

public List<List<Integer>> threeSum(int[] nums) {


[Link](nums);

ArrayList<List<Integer>> result = new ArrayList<>();

for (int i = 0; i < [Link]; i++) {


int j = i + 1;
int k = [Link] - 1;

if (i > 0 && nums[i] == nums[i - 1]) {


continue;
}

while (j < k) {
if (k < [Link] - 1 && nums[k] == nums[k + 1]) {
k--;
continue;
}

if (nums[i] + nums[j] + nums[k] > 0) {


k--;
} else if (nums[i] + nums[j] + nums[k] < 0) {
j++;
} else {
ArrayList<Integer> l = new ArrayList<>();
[Link](nums[i]);
[Link](nums[j]);
[Link](nums[k]);
[Link](l);
j++;

58 | 568
30 3Sum

k--;
}
}
}

return result;
}

Program Creek 59 | 568


31 4Sum
Given an array S of n integers, are there elements a, b, c, and d in S such that a + b + c + d = target? Find all
unique quadruplets in the array which gives the sum of target.
Note: Elements in a quadruplet (a,b,c,d) must be in non-descending order. (ie, a ≤ b ≤ c ≤ d) The solution set
must not contain duplicate quadruplets.

For example, given array S = {1 0 -1 0 -2 2}, and target = 0.

A solution set is:


(-1, 0, 0, 1)
(-2, -1, 1, 2)
(-2, 0, 0, 2)

31.1 Java Solution


A typical k-sum problem. Time is N to the power of (k-1).

public List<List<Integer>> fourSum(int[] nums, int target) {


List<List<Integer>> result = new ArrayList<List<Integer>>();

if(nums==null|| [Link]<4)
return result;

[Link](nums);

for(int i=0; i<[Link]-3; i++){


if(i!=0 && nums[i]==nums[i-1])
continue;
for(int j=i+1; j<[Link]-2; j++){
if(j!=i+1 && nums[j]==nums[j-1])
continue;
int k=j+1;
int l=[Link]-1;
while(k<l){
if(nums[i]+nums[j]+nums[k]+nums[l]<target){
k++;
}else if(nums[i]+nums[j]+nums[k]+nums[l]>target){
l--;
}else{
List<Integer> t = new ArrayList<Integer>();
[Link](nums[i]);
[Link](nums[j]);
[Link](nums[k]);
[Link](nums[l]);
[Link](t);

k++;
l--;

60 | 568
31 4Sum

while(k<l &&nums[l]==nums[l+1] ){
l--;
}

while(k<l &&nums[k]==nums[k-1]){
k++;
}
}

}
}
}

return result;
}

Program Creek 61 | 568


32 3Sum Closest
Given an array S of n integers, find three integers in S such that the sum is closest to a given number, target.
Return the sum of the three integers. You may assume that each input would have exactly one solution.

For example, given array S = {-1 2 1 -4}, and target = 1.


The sum that is closest to the target is 2. (-1 + 2 + 1 = 2).

32.1 Analysis
This problem is similar to 2 Sum. This kind of problem can be solved by using a similar approach, i.e., two
pointers from both left and right.

32.2 Java Solution

public int threeSumClosest(int[] nums, int target) {


int min = Integer.MAX_VALUE;
int result = 0;

[Link](nums);

for (int i = 0; i < [Link]; i++) {


int j = i + 1;
int k = [Link] - 1;
while (j < k) {
int sum = nums[i] + nums[j] + nums[k];
int diff = [Link](sum - target);

if(diff == 0) return sum;

if (diff < min) {


min = diff;
result = sum;
}
if (sum <= target) {
j++;
} else {
k--;
}
}
}

return result;
}

Time Complexity is O(n2̂).

62 | 568
33 Wiggle Sort
Given an unsorted array nums, reorder it in-place such that nums[0] <nums[1] >nums[2] <nums[3].... Example:

Input: nums = [3,5,2,1,6,4]


Output: One possible answer is [3,5,1,6,2,4]

33.1 Java Solution

public void wiggleSort(int[] nums) {


if (nums == null || [Link] <= 1) {
return;
}

for (int i = 1; i < [Link]; i++) {


if (i % 2 == 1) {
if (nums[i - 1] > nums[i]) {
swap(nums, i - 1, i);
}
} else {
if (nums[i - 1] < nums[i]) {
swap(nums, i - 1, i);
}
}
}
}

private void swap(int[] nums, int i, int j) {


int t = nums[i];
nums[i] = nums[j];
nums[j] = t;
}

63 | 568
34 Wiggle Subsequence
Given a sequence of integers, return the length of the longest subsequence that is a wiggle sequence. A sub-
sequence is obtained by deleting some number of elements (eventually, also zero) from the original sequence,
leaving the remaining elements in their original order.

34.1 Java Solution


The problem is converted to finding the turning point. When nums[i] <nums[i+1], we want to keep going to the
right until finding the largest one, which is the turning point. Similarly, when nums[i] >nums[i+1], we want to
keep going to the right until finding the smallest one, which is the turning point. We always want to use the
largest or smallest as the turning point because that guarantees the optimal solution.

public int wiggleMaxLength(int[] nums) {


if(nums == null || [Link]==0)
return 0;
if([Link]<2){
return [Link];
}

int count=1;

for(int i=1, j=0; i<[Link]; j=i, i++){


if(nums[j]<nums[i]){
count++;
while(i<[Link]-1 && nums[i]<=nums[i+1]){
i++;
}
}else if(nums[j]>nums[i]){
count++;
while(i<[Link]-1 && nums[i]>=nums[i+1]){
i++;
}
}
}

return count;
}

64 | 568
35 Longest Common Prefix

35.1 Problem
Write a function to find the longest common prefix string amongst an array of strings.

35.2 Analysis
To solve this problem, we need to find the two loop conditions. One is the length of the shortest string. The other
is iteration over every element of the string array.

35.3 Java Solution

public String longestCommonPrefix(String[] strs) {


if(strs==null || [Link] ==0){
return "";
}

if([Link] == 1){
return strs[0];
}

int i=0;
while(true){
boolean flag = true;
for(int j=1; j<[Link]; j++){
if(strs[j].length()<=i || strs[j-1].length() <=i
|| strs[j].charAt(i) != strs[j-1].charAt(i)){
flag = false;
break;
}
}

if(flag){
i++;
}else{
break;
}
}

return strs[0].substring(0, i);


}

65 | 568
36 Next Permutation
Implement next permutation, which rearranges numbers into the lexicographically next greater permutation of
numbers.
If such arrangement is not possible, it must rearrange it as the lowest possible order (ie, sorted in ascending
order). The replacement must be in-place, do not allocate extra memory.
Here are some examples. Inputs are in the left-hand column and its corresponding outputs are in the right-hand
column.

1,2,3 [U+FFFD] 1,3,2


3,2,1 [U+FFFD] 1,2,3
1,1,5 [U+FFFD] 1,5,1

36.1 Analysis
The steps to solve this problem: 1) scan from right to left, find the first element that is less than its previous one.

4 5 6 3 2 1
|
p

2) scan from right to left, find the first element that is greater than p.

4 5 6 3 2 1
|
q

3) swap p and q

4 5 6 3 2 1
swap
4 6 5 3 2 1

4) reverse elements [p+1, [Link]]

4 6 1 2 3 5

36.2 Java Solution

public void nextPermutation(int[] nums) {


//find first decreasing digit
int mark = -1;
for (int i = [Link] - 1; i > 0; i--) {
if (nums[i] > nums[i - 1]) {
mark = i - 1;
break;
}

66 | 568
36 Next Permutation

if (mark == -1) {
reverse(nums, 0, [Link] - 1);
return;
}

int idx = [Link]-1;


for (int i = [Link]-1; i >= mark+1; i--) {
if (nums[i] > nums[mark]) {
idx = i;
break;
}
}

swap(nums, mark, idx);

reverse(nums, mark + 1, [Link] - 1);


}

private void swap(int[] nums, int i, int j) {


int t = nums[i];
nums[i] = nums[j];
nums[j] = t;
}

private void reverse(int[] nums, int i, int j) {


while (i < j) {
swap(nums, i, j);
i++;
j--;
}
}

Program Creek 67 | 568


37 Search Insert Position
Given a sorted array and a target value, return the index if the target is found. If not, return the index where it
would be if it were inserted in order. You may assume no duplicates in the array.
Here are few examples.

[1,3,5,6], 5 -> 2
[1,3,5,6], 2 -> 1
[1,3,5,6], 7 -> 4
[1,3,5,6], 0 -> 0

37.1 Java Solution


This is a binary search problem. The complexity should be O(log(n)).

public int searchInsert(int[] nums, int target) {


if(target>nums[[Link]-1]){
return [Link];
}

int l=0;
int r=[Link]-1;

while(l<r){
int m = l+(r-l)/2;
if(target>nums[m]){
l=m+1;
}else{
r=m;
}
}

return l;
}

Or similarly, we can write the solution like the following:

public int searchInsert(int[] nums, int target) {


int i=0;
int j=[Link]-1;

while(i<=j){
int mid = (i+j)/2;

if(target > nums[mid]){


i=mid+1;
}else if(target < nums[mid]){
j=mid-1;
}else{
return mid;

68 | 568
37 Search Insert Position

}
}

return i;
}

Program Creek 69 | 568


38 Median of Two Sorted Arrays
There are two sorted arrays A and B of size m and n respectively. Find the median of the two sorted arrays. The overall
run time complexity should be O(log (m+n)).

38.1 Java Solution


This problem can be converted to the problem of finding kth element, k is (A’s length + B’ Length)/2.
If any of the two arrays is empty, then the kth element is the non-empty array’s kth element. If k == 0, the kth
element is the first element of A or B.
For normal cases(all other cases), we need to move the pointer at the pace of half of the array size to get
O(log(n)) time.

public double findMedianSortedArrays(int[] nums1, int[] nums2) {


int total = [Link]+[Link];
if(total%2==0){
return (getKth(nums1, 0, [Link]-1, nums2, 0, [Link]-1, total/2)
+ getKth(nums1, 0, [Link]-1, nums2, 0, [Link]-1, total/2-1))/2.0;
}else{
return getKth(nums1,0, [Link]-1, nums2, 0, [Link]-1, total/2);
}
}

//k is the index starting from 0


private int getKth(int[] nums1, int i1, int j1, int[] nums2, int i2, int j2, int k){
if(j1<i1){
return nums2[i2+k];
}
if(j2<i2){
return nums1[i1+k];
}

if(k==0){
return [Link](nums1[i1], nums2[i2]);
}

int len1 = j1 - i1 + 1;
int len2 = j2 - i2 + 1;

int m1 = k*len1/(len1+len2);
int m2 = k - m1 - 1;

m1 += i1;
m2 += i2;

if(nums1[m1]<nums2[m2]){
k = k-(m1-i1+1);
j2 = m2;
i1 = m1+1;
}else{
k = k-(m2-i2+1);

70 | 568
38 Median of Two Sorted Arrays

j1 = m1;
i2 = m2+1;
}

return getKth(nums1, i1, j1, nums2, i2, j2, k);


}

The main challenge is to calculate the middle elements, we can not do the following like a regular binary search:

int m1 = i1+(j1-i1)/2;
int m2 = i2+(j2-i2)/2;

It will result in either dead loop or missing the element at the beginning. The key is we always drop <= half
size of the elements.

Program Creek 71 | 568


39 Find Minimum in Rotated Sorted Array
Suppose a sorted array is rotated at some pivot unknown to you beforehand. (i.e., 0 1 2 4 5 6 7 might become 4 5
6 7 0 1 2).
Find the minimum [Link] may assume no duplicate exists in the array.

39.1 Analysis
This problem is a binary search and the key is breaking the array to two parts, so that we can work on half of the
array each time.
If we pick the middle element, we can compare the middle element with the leftmost (or rightmost) element. If
the middle element is less than leftmost, the left half should be selected; if the middle element is greater than the
leftmost (or rightmost), the right half should be selected. Using recursion or iteration, this problem can be solved
in time log(n).
In addition, in any rotated sorted array, the rightmost element should be less than the left-most element,
otherwise, the sorted array is not rotated and we can simply pick the leftmost element as the minimum.

39.2 Java Solution 1 - Recursion


Define a helper function, otherwise, we will need to use [Link]() function, which may be expensive
for large arrays.

72 | 568
39 Find Minimum in Rotated Sorted Array

public int findMin(int[] num) {


return findMin(num, 0, [Link] - 1);
}

public int findMin(int[] num, int left, int right) {


if (left == right)
return num[left];
if ((right - left) == 1)
return [Link](num[left], num[right]);

int middle = left + (right - left) / 2;

// not rotated
if (num[left] < num[right]) {
return num[left];

// go right side
} else if (num[middle] > num[left]) {
return findMin(num, middle, right);

// go left side
} else {
return findMin(num, left, middle);
}
}

39.3 Java Solution 2 - Iteration

/*
To understand the boundaries, use the following 3 examples:
[2,1], [2,3,1], [3,1,2]
*/
public int findMin(int[] nums) {
if(nums==null || [Link]==0)
return -1;

int i=0;
int j=[Link]-1;

while(i<=j){
if(nums[i]<=nums[j])
return nums[i];

int m=(i+j)/2;

if(nums[m]>=nums[i]){
i=m+1;
}else{
j=m;
}
}

return -1;
}

Program Creek 73 | 568


40 Find Minimum in Rotated Sorted Array II
Follow up for "Find Minimum in Rotated Sorted Array": What if duplicates are allowed?
Would this affect the run-time complexity? How and why?

40.1 Java Solution 1 - Recursion


This is a follow-up problem of finding minimum element in rotated sorted array without duplicate elements. We
only need to add one more condition, which checks if the left-most element and the right-most element are equal.
If they are we can simply drop one of them. In my solution below, I drop the left element whenever the left-most
equals to the right-most.

public int findMin(int[] num) {


return findMin(num, 0, [Link]-1);
}

public int findMin(int[] num, int left, int right){


if(right==left){
return num[left];
}
if(right == left +1){
return [Link](num[left], num[right]);
}
// 3 3 1 3 3 3

int middle = (right-left)/2 + left;


// already sorted
if(num[right] > num[left]){
return num[left];
//right shift one
}else if(num[right] == num[left]){
return findMin(num, left+1, right);
//go right
}else if(num[middle] >= num[left]){
return findMin(num, middle, right);
//go left
}else{
return findMin(num, left, middle);
}
}

40.2 Java Solution 2 - Iteration

public int findMin(int[] nums) {


int i=0;
int j=[Link]-1;

while(i<=j){

74 | 568
40 Find Minimum in Rotated Sorted Array II

//handle cases like [3, 1, 3]


while(nums[i]==nums[j] && i!=j){
i++;
}

if(nums[i]<=nums[j]){
return nums[i];
}

int m=(i+j)/2;
if(nums[m]>=nums[i]){
i=m+1;
}else{
j=m;
}
}

return -1;
}

Program Creek 75 | 568


41 Find First and Last Position of Element in
Sorted Array
Given a sorted array of integers, find the starting and ending position of a given target value. Your algorithm’s
runtime complexity must be in the order of O(log n). If the target is not found in the array, return [-1, -1]. For
example, given [5, 7, 7, 8, 8, 10] and target value 8, return [3, 4].

41.1 Analysis
Based on the requirement of O(log n), this is a binary search problem apparently.

41.2 Java Solution 1 - Log(n)


We can first find the start and then the end of the target.

public int[] searchRange(int[] nums, int target) {


int l=0;
int r=[Link]-1;

while(l<r){
int m=l+(r-l)/2;
if(nums[m]<target){
l=m+1;
}else{
r=m;
}
}

int first=l;
if(l<[Link]&&nums[l]==target){//l is in boundary and is the target
l=0;
r=[Link]-1;
while(l<r){
int m=l+(r-l+1)/2;
if(nums[m]>target){
r=m-1;
}else{
l=m;
}
}

return new int[]{first, r};


}

return new int[]{-1,-1};


}

76 | 568
41 Find First and Last Position of Element in Sorted Array

41.3 Java Solution 2 - (Deprecated)

public int[] searchRange(int[] nums, int target) {


if(nums == null || [Link] == 0){
return null;
}

int[] arr= new int[2];


arr[0]=-1;
arr[1]=-1;

binarySearch(nums, 0, [Link]-1, target, arr);

return arr;
}

public void binarySearch(int[] nums, int left, int right, int target, int[] arr){
if(right<left)
return;

if(nums[left]==nums[right] && nums[left]==target){


arr[0]=left;
arr[1]=right;
return;
}

int mid = left+(right-left)/2;

if(nums[mid]<target){
binarySearch(nums, mid+1, right, target, arr);
}else if(nums[mid]>target){
binarySearch(nums, left, mid-1, target, arr);
}else{
arr[0]=mid;
arr[1]=mid;

//handle duplicates - left


int t1 = mid;
while(t1 >left && nums[t1]==nums[t1-1]){
t1--;
arr[0]=t1;
}

//handle duplicates - right


int t2 = mid;
while(t2 < right&& nums[t2]==nums[t2+1]){
t2++;
arr[1]=t2;
}
return;
}
}

In the worst case, the time of the second solution is actually O(n).

Program Creek 77 | 568


42 Guess Number Higher or Lower
We are playing the Guess Game. The game is as follows:
I pick a number from 1 to n. You have to guess which number I picked.
Every time you guess wrong, I’ll tell you whether the number is higher or lower.
You call a pre-defined API guess(int num) which returns 3 possible results (-1, 1, or 0):
-1 : My number is lower 1 : My number is higher 0 : Congrats! You got it! Example: n = 10, I pick 6.
Return 6.

42.1 Java Solution


This is a typical binary search problem. Here is a Java solution.

public int guessNumber(int n) {


int low=1;
int high=n;

while(low <= high){


int mid = low+((high-low)/2);
int result = guess(mid);
if(result==0){
return mid;
}else if(result==1){
low = mid+1;
}else{
high=mid-1;
}
}

return -1;
}

42.2 What we learn from this problem?


low+(high-low)/2 yields the same value with (low+high)/2. However, the first expression is less expensive. In
addition, the following expression can be used:

low+((high-low)>>1)
(low+high)>>>1

Under the assumption that high and low are both non-negative, we know for sure that the upper-most bit (the
sign-bit) is zero.
So both high and low are in fact 31-bit integers.

high = 0100 0000 0000 0000 0000 0000 0000 0000 = 1073741824
low = 0100 0000 0000 0000 0000 0000 0000 0000 = 1073741824

When you add them together they may "spill" over into the top-bit.

78 | 568
42 Guess Number Higher or Lower

high + low = 1000 0000 0000 0000 0000 0000 0000 0000
= 2147483648 as unsigned 32-bit integer
= -2147483648 as signed 32-bit integer

(high + low) / 2 = 1100 0000 0000 0000 0000 0000 0000 0000 = -1073741824
(high + low) >>> 1 = 0100 0000 0000 0000 0000 0000 0000 0000 = 1073741824

Program Creek 79 | 568


43 First Bad Version
You are a product manager and currently leading a team to develop a new product. Unfortunately, the latest
version of your product fails the quality check. Since each version is developed based on the previous version, all
the versions after a bad version are also bad.
Suppose you have n versions [1, 2, ..., n] and you want to find out the first bad one, which causes all the
following ones to be bad.
You are given an API bool isBadVersion(version) which will return whether version is bad. Implement a
function to find the first bad version. You should minimize the number of calls to the API.

43.1 Java Solution 1 - Recurisve

public int firstBadVersion(int n) {


return helper(1, n);
}

public int helper(int i, int j){


int m = i + (j-i)/2;

if(i>=j)
return i;

if(isBadVersion(m)){
return helper(i, m);
}else{
return helper(m+1, j); //not bad, left --> m+1
}
}

43.2 Java Solution 2 - Iterative

public int firstBadVersion(int n) {


int i = 1, j = n;
while (i < j) {
int m = i + (j-i) / 2;
if (isBadVersion(m)) {
j = m;
} else {
i = m+1;
}
}

if (isBadVersion(i)) {
return i;
}

return j;

80 | 568
43 First Bad Version

Program Creek 81 | 568


44 Search in Rotated Sorted Array
Suppose a sorted array is rotated at some pivot unknown to you beforehand. (i.e., 0 1 2 4 5 6 7 might become 4 5
6 7 0 1 2).
You are given a target value to search. If found in the array return its index, otherwise return -1. You may
assume no duplicate exists in the array.

44.1 Analysis
In order to use binary search on the rotated sorted array, we need to determine how to update the left and right
pointers. There are two major cases as shown below:

Once the two cases are identified, the problem is straightforward to solve. We only need to check if the target
element is in the sorted side, and based on that move left or right pointers.

44.2 Java Solution 1- Recusive

public int search(int[] nums, int target) {


return binarySearch(nums, 0, [Link]-1, target);
}

public int binarySearch(int[] nums, int left, int right, int target){
if(left>right)

82 | 568
44 Search in Rotated Sorted Array

return -1;

int mid = left + (right-left)/2;

if(target == nums[mid])
return mid;

if(nums[left] <= nums[mid]){


if(nums[left]<=target && target<nums[mid]){
return binarySearch(nums,left, mid-1, target);
}else{
return binarySearch(nums, mid+1, right, target);
}
}else {
if(nums[mid]<target&& target<=nums[right]){
return binarySearch(nums,mid+1, right, target);
}else{
return binarySearch(nums, left, mid-1, target);
}
}
}

44.3 Java Solution 2 - Iterative

public int search(int[] nums, int target) {


int left = 0;
int right= [Link]-1;

while(left<=right){
int mid = left + (right-left)/2;
if(target==nums[mid])
return mid;

if(nums[left]<=nums[mid]){
if(nums[left]<=target&& target<nums[mid]){
right=mid-1;
}else{
left=mid+1;
}
}else{
if(nums[mid]<target&& target<=nums[right]){
left=mid+1;
}else{
right=mid-1;
}
}
}

return -1;
}

Program Creek 83 | 568


45 Search in Rotated Sorted Array II
Follow up for "Search in Rotated Sorted Array": what if duplicates are allowed? Write a function to determine if
a given target is in the array.

45.1 Java Solution

public boolean search(int[] nums, int target) {


int left=0;
int right=[Link]-1;

while(left<=right){
int mid = (left+right)/2;
if(nums[mid]==target)
return true;

if(nums[left]<nums[mid]){
if(nums[left]<=target&& target<nums[mid]){
right=mid-1;
}else{
left=mid+1;
}
}else if(nums[left]>nums[mid]){
if(nums[mid]<target&&target<=nums[right]){
left=mid+1;
}else{
right=mid-1;
}
}else{
left++;
}
}

return false;
}

84 | 568
46 Longest Increasing Subsequence
Given an unsorted array of integers, find the length of longest increasing subsequence.
For example, given [10, 9, 2, 5, 3, 7, 101, 18], the longest increasing subsequence is [2, 3, 7, 101]. Therefore the
length is 4.

46.1 Java Solution 1 - Naive


Let max[i] represent the length of the longest increasing subsequence so far. If any element before i is smaller
than nums[i], then max[i] = max(max[i], max[j]+1).
Here is an example:

public int lengthOfLIS(int[] nums) {


if(nums==null || [Link]==0)
return 0;

int[] max = new int[[Link]];

for(int i=0; i<[Link]; i++){


max[i]=1;
for(int j=0; j<i;j++){
if(nums[i]>nums[j]){

85 | 568
46 Longest Increasing Subsequence

max[i]=[Link](max[i], max[j]+1);
}
}
}

int result = 0;
for(int i=0; i<[Link]; i++){
if(max[i]>result)
result = max[i];
}
return result;
}

Or, simplify the code as:

public int lengthOfLIS(int[] nums) {


if(nums==null || [Link]==0)
return 0;

int[] max = new int[[Link]];


[Link](max, 1);

int result = 1;
for(int i=0; i<[Link]; i++){
for(int j=0; j<i; j++){
if(nums[i]>nums[j]){
max[i]= [Link](max[i], max[j]+1);

}
}
result = [Link](max[i], result);
}

return result;
}

46.2 Java Solution 2 - Binary Search


We can put the increasing sequence in a list.

for each num in nums


if([Link]()==0)
add num to list
else if(num > last element in list)
add num to list
else
replace the element in the list which is the smallest but bigger than num

Program Creek 86 | 568


46 Longest Increasing Subsequence

public int lengthOfLIS(int[] nums) {


if(nums==null || [Link]==0)
return 0;

ArrayList<Integer> list = new ArrayList<Integer>();

for(int num: nums){


if([Link]()==0 || num>[Link]([Link]()-1)){
[Link](num);
}else{
int i=0;
int j=[Link]()-1;

while(i<j){
int mid = (i+j)/2;
if([Link](mid) < num){
i=mid+1;
}else{
j=mid;
}
}

[Link](j, num);
}
}

return [Link]();
}

Note that the problem asks the length of the sequence, not the sequence itself.

Program Creek 87 | 568


47 Count of Smaller Numbers After Self
You are given an integer array nums and you have to return a new counts array. The counts array has the property
where counts[i] is the number of smaller elements to the right of nums[i].
Example:
Input: [5,2,6,1] Output: [2,1,1,0]

47.1 Java Solution 1

public List<Integer> countSmaller(int[] nums) {


List<Integer> result = new ArrayList<Integer>();
ArrayList<Integer> sorted = new ArrayList<Integer>();

for(int i=[Link]-1; i>=0; i--){


if([Link]()){
[Link](nums[i]);
[Link](0);
}else if(nums[i]>[Link]([Link]()-1)){
[Link]([Link](), nums[i]);
[Link]([Link]()-1);
}else{
int l=0;
int r=[Link]()-1;

while(l<r){
int m = l + (r-l)/2;

if(nums[i]>[Link](m)){
l=m+1;
}else{
r=m;
}
}

[Link](r, nums[i]);
[Link](r);
}
}

[Link](result);

return result;
}

This solution is simple. However, note that time complexity of adding an element to a list is O(n), because
elements after the insertion position need to be shifted. So the time complexity is O(n2̂(logn)).

88 | 568
47 Count of Smaller Numbers After Self

47.2 Java Solution 2


If we want to use binary search, and define a structure like the following:

On average, time complexity is O(n*log(n)) and space complexity is O(n).

class Solution {
public List<Integer> countSmaller(int[] nums) {

List<Integer> result = new ArrayList<Integer>();


if(nums==null || [Link]==0){
return result;
}

Node root = new Node(nums[[Link]-1]);


[Link]=1;
[Link](0);

for(int i=[Link]-2; i>=0; i--){


[Link](insertNode(root, nums[i]));
}

[Link](result);

return result;
}

public int insertNode(Node root, int value){


Node p=root;
int result=0;

Program Creek 89 | 568


47 Count of Smaller Numbers After Self

while(p!=null){
if(value>[Link]){
result+=[Link]+[Link];
if([Link]==null){
Node t = new Node(value);
[Link]=1;
[Link]=t;
return result;
}else{
p=[Link];
}
}else if(value==[Link]){
[Link]++;
return result+[Link];
}else{
[Link]++;

if([Link]==null){
Node t = new Node(value);
[Link]=1;
[Link]=t;
return result;
}else{
p=[Link];
}
}
}

return 0;
}
}

class Node{
Node left;
Node right;

int value;
int count;
int numLeft;
public Node(int value){
[Link]=value;
}
}

Program Creek 90 | 568


48 Russian Doll Envelopes
You have a number of envelopes with widths and heights given as a pair of integers (w, h). One envelope can fit
into another if and only if both the width and height of one envelope is greater than the width and height of the
other envelope.
What is the maximum number of envelopes can you Russian doll? (put one inside other)

48.1 Java Solution 1 - Naive

public int maxEnvelopes(int[][] envelopes) {


if(envelopes==null||[Link]==0)
return 0;

[Link](envelopes, new Comparator<int[]>(){


public int compare(int[] a, int[] b){
if(a[0]!=b[0]){
return a[0]-b[0];
}else{
return a[1]-b[1];
}
}
});
int max=1;
int[] arr = new int[[Link]];
for(int i=0; i<[Link]; i++){
arr[i]=1;
for(int j=i-1; j>=0; j--){
if(envelopes[i][0]>envelopes[j][0]&&envelopes[i][1]>envelopes[j][1]){
arr[i]=[Link](arr[i], arr[j]+1);
}
}
max = [Link](max, arr[i]);
}

return max;
}

48.2 Java Solution 2 - Binary Search


We can sort the envelopes by height in ascending order and width in descending order. Then look at the width
and find the longest increasing subsequence. This problem is then converted to the problem of finding Longeset
Increasing Subsequence.

public int maxEnvelopes(int[][] envelopes) {


Comparator c = [Link]((int[] arr) -> arr[0])
.thenComparing((int[] arr) -> arr[1], [Link]());
[Link](envelopes, c);

91 | 568
48 Russian Doll Envelopes

ArrayList<Integer> list = new ArrayList<>();

for(int[] arr: envelopes){


int target = arr[1];

if([Link]()||target>[Link]([Link]()-1)){
[Link](target);
}else{
int i=0;
int j=[Link]()-1;

while(i<j){
int m = i + (j-i)/2;
if([Link](m)>=target){
j = m;
}else{
i = m+1;
}
}

[Link](j, target);
}
}

return [Link]();
}

Time complexity is O(n*log(n)) and we need O(n) of space for the list.

Program Creek 92 | 568


49 HIndex
Given an array of citations (each citation is a non-negative integer) of a researcher, write a function to compute
the researcher’s h-index. A scientist has index h if h of his/her N papers have at least h citations each, and the
other N − h papers have no more than h citations each.
For example, given citations = [3, 0, 6, 1, 5], which means the researcher has 5 papers in total and each of them
had received 3, 0, 6, 1, 5 citations respectively. Since the researcher has 3 papers with at least 3 citations each and
the remaining two with no more than 3 citations each, his h-index is 3.

49.1 Java Solution 1

public int hIndex(int[] citations) {


[Link](citations);

int result = 0;
for(int i=[Link]-1; i>=0; i--){
int cnt = [Link]-i;
if(citations[i]>=cnt){
result = cnt;
}else{
break;
}
}

return result;
}

93 | 568
49 HIndex

49.2 Java Solution 2


We can also put the citations in a counting sort array, then iterate over the counter array.

public int hIndex(int[] citations) {


int len = [Link];
int[] counter = new int[len+1];

for(int c: citations){
counter[[Link](len,c)]++;
}

int k=len;
for(int s=counter[len]; k > s; s += counter[k]){
k--;
}

return k;
}

Program Creek 94 | 568


50 HIndex II
Follow up for H-Index: What if the citations array is sorted in ascending order? Could you optimize your
algorithm?

50.1 Java Solution


Given the array is sorted, we should use binary search.

int hIndex(int[] citations) {


int len = [Link];

if (len == 0) {
return 0;
}

if (len == 1) {
if (citations[0] == 0) {
return 0;
} else {
return 1;
}
}

int i = 0;
int j = len - 1;
while (i < j) {
int m = i + (j - i + 1) / 2;
if (citations[m] > len - m) {
j = m - 1;
} else {
i = m;
}
}

if (citations[j] > len - j) {


return len;
}

if (citations[j] == len - j) {
return len - j;
} else {
return len - j - 1;
}
}

95 | 568
51 Valid Anagram
Given two strings s and t, write a function to determine if t is an anagram of s.

51.1 Java Solution 1


Assuming the string contains only lowercase alphabets, here is a simple solution.

public boolean isAnagram(String s, String t) {


if(s==null || t==null)
return false;

if([Link]()!=[Link]())
return false;

int[] arr = new int[26];


for(int i=0; i<[Link](); i++){
arr[[Link](i)-’a’]++;
arr[[Link](i)-’a’]--;
}

for(int i: arr){
if(i!=0)
return false;
}

return true;
}

51.2 Java Solution 2


If the inputs contain unicode characters, an array with length of 26 is not enough.

public boolean isAnagram(String s, String t) {


if([Link]()!=[Link]())
return false;

HashMap<Character, Integer> map = new HashMap<Character, Integer>();

for(int i=0; i<[Link](); i++){


char c1 = [Link](i);
if([Link](c1)){
[Link](c1, [Link](c1)+1);
}else{
[Link](c1,1);
}
}

for(int i=0; i<[Link](); i++){

96 | 568
51 Valid Anagram

char c2 = [Link](i);
if([Link](c2)){
if([Link](c2)==1){
[Link](c2);
}else{
[Link](c2, [Link](c2)-1);
}
}else{
return false;
}
}

if([Link]()>0)
return false;

return true;
}

Program Creek 97 | 568


52 Group Shifted Strings
Given a string, we can "shift" each of its letter to its successive letter, for example: "abc" ->"bcd". We can keep
"shifting" which forms the sequence: "abc" ->"bcd" ->... ->"xyz".
Given a list of strings which contains only lowercase alphabets, group all strings that belong to the same shifting
sequence, return:

[
["abc","bcd","xyz"],
["az","ba"],
["acef"],
["a","z"]
]

52.1 Java Solution

public List<List<String>> groupStrings(String[] strings) {


List<List<String>> result = new ArrayList<List<String>>();
HashMap<String, ArrayList<String>> map
= new HashMap<String, ArrayList<String>>();

for(String s: strings){
char[] arr = [Link]();
if([Link]>0){
int diff = arr[0]-’a’;
for(int i=0; i<[Link]; i++){
if(arr[i]-diff<’a’){
arr[i] = (char) (arr[i]-diff+26);
}else{
arr[i] = (char) (arr[i]-diff);
}

}
}

String ns = new String(arr);


if([Link](ns)){
[Link](ns).add(s);
}else{
ArrayList<String> al = new ArrayList<String>();
[Link](s);
[Link](ns, al);
}
}

for([Link]<String, ArrayList<String>> entry: [Link]()){


[Link]([Link]());
}

98 | 568
52 Group Shifted Strings

[Link]([Link]());

return result;
}

Program Creek 99 | 568


53 Palindrome Pairs
Given a list of unique words. Find all pairs of distinct indices (i, j) in the given list, so that the concatenation of
the two words, i.e. words[i] + words[j] is a palindrome.
Example 1: Given words = ["bat", "tab", "cat"] Return [[0, 1], [1, 0]] The palindromes are ["battab", "tabbat"]

53.1 Java Solution

public List<List<Integer>> palindromePairs(String[] words) {


List<List<Integer>> result = new ArrayList<>();
if(words == null || [Link] < 2){
return result;
}

HashMap<String, Integer> map = new HashMap<>();


for(int i=0; i<[Link]; i++){
[Link](words[i], i);
}

for(int i=0; i<[Link]; i++){


String s = words[i];

for(int k=0; k<=[Link](); k++){


String left = [Link](0, k);
String right= [Link](k);

//if left part is palindrome, find reversed right part


if(isPalindrome(left)){
String reversedRight = new StringBuilder(right).reverse().toString();
if([Link](reversedRight) && [Link](reversedRight) != i){
ArrayList<Integer> l = new ArrayList<>();
[Link]([Link](reversedRight));
[Link](i);
[Link](l);
}
}

//if right part is a palindrome, find reversed left part


if(isPalindrome(right)){
String reversedLeft = new StringBuilder(left).reverse().toString();
if([Link](reversedLeft)
&& [Link](reversedLeft) != i
&& [Link]() != 0){
//make sure right is not "", already handled in the if above
ArrayList<Integer> l = new ArrayList<>();
[Link](i);
[Link]([Link](reversedLeft));
[Link](l);
}
}

100 | 568
53 Palindrome Pairs

}
}

return result;
}

public boolean isPalindrome(String s){


int i=0;
int j=[Link]()-1;

while(i<=j){
if([Link](i)!=[Link](j)){
return false;
}
i++;
j--;
}

return true;
}

Time complexity is O(n*k2̂), where n is the number of words and k is the average length of each word.

Program Creek 101 | 568


54 Line Reflection
Given n points on a 2D plane, find if there is such a line parallel to y-axis that reflects the given points.
Example 1: Given points = [[1,1],[-1,1]], return true.
Example 2: Given points = [[1,1],[-1,-1]], return false.
Follow up: Could you do better than O(n2)?

54.1 Java Solution


For this problem, we first find the smallest and largest x-value for all points and get the line’s x-axis is (minX +
maxX) / 2, then for each point, check if each point has a reflection points in the set.

public boolean isReflected(int[][] points) {


if(points==null || [Link]<2)
return true;

HashMap<Integer, HashSet<Integer>> map = new HashMap<Integer, HashSet<Integer>>();

int min=Integer.MAX_VALUE;
int max=Integer.MIN_VALUE;

for(int[] arr: points){


min = [Link](min, arr[0]);
max = [Link](max, arr[0]);
HashSet<Integer> set = [Link](arr[0]);
if(set==null){
set = new HashSet<Integer>();
[Link](arr[0], set);
}

[Link](arr[1]);

int y = min+max;

for(int[] arr: points){


int left = arr[0];
int right = y-left;
if([Link](right)==null || ![Link](right).contains(arr[1])){
return false;
}
}

return true;
}

102 | 568
55 Isomorphic Strings
Given two strings s and t, determine if they are isomorphic. Two strings are isomorphic if the characters in s can
be replaced to get t.
For example,"egg" and "add" are isomorphic, "foo" and "bar" are not.

55.1 Analysis
We can define a map which tracks the char-char mappings. If a value is already mapped, it can not be mapped
again.

55.2 Java Solution

public boolean isIsomorphic(String s, String t) {


if([Link]()!=[Link]()){
return false;
}

HashMap<Character, Character> map1 = new HashMap<>();


HashMap<Character, Character> map2 = new HashMap<>();

for(int i=0; i<[Link](); i++){


char c1 = [Link](i);
char c2 = [Link](i);

if([Link](c1)){
if(c2!=[Link](c1)){
return false;
}
}else{
if([Link](c2)){
return false;
}

[Link](c1, c2);
[Link](c2, c1);
}
}

return true;
}

Time complexity is O(n) and space complexity is O(n), where n is the length of the input string.

103 | 568
56 Two Sum
Given an array of integers, find two numbers such that they add up to a specific target number.
The function twoSum should return indices of the two numbers such that they add up to the target, where
index1 must be less than index2. Please note that your returned answers (both index1 and index2) are not
zero-based.
For example:

Input: numbers={2, 7, 11, 15}, target=9


Output: index1=0, index2=1

56.1 Java Solution


The optimal solution to solve this problem is using a HashMap. For each element of the array, (target-nums[i])
and the index are stored in the HashMap.

public int[] twoSum(int[] nums, int target) {


if(nums==null || [Link]<2)
return new int[]{0,0};

HashMap<Integer, Integer> map = new HashMap<Integer, Integer>();


for(int i=0; i<[Link]; i++){
if([Link](nums[i])){
return new int[]{[Link](nums[i]), i};
}else{
[Link](target-nums[i], i);
}
}

return new int[]{0,0};


}

Time complexity is O(n).

104 | 568
57 Maximum Size Subarray Sum Equals k
Given an array nums and a target value k, find the maximum length of a subarray that sums to k. If there isn’t
one, return 0 instead.
Note: The sum of the entire nums array is guaranteed to fit within the 32-bit signed integer range.
Example 1: Given nums = [1, -1, 5, -2, 3], k = 3, return 4. (because the subarray [1, -1, 5, -2] sums to 3 and is the
longest)

57.1 Java Solution


This problem is similar to Maximum Sum of SubArray Close to K.

public int maxSubArrayLen(int[] nums, int k) {


HashMap<Integer, Integer> map = new HashMap<Integer, Integer>();

int max = 0;

int sum=0;
for(int i=0; i<[Link]; i++){
sum += nums[i];

if(sum==k){

105 | 568
57 Maximum Size Subarray Sum Equals k

max = [Link](max, i+1);


}

int diff = sum-k;

if([Link](diff)){
max = [Link](max, [Link](diff));
}

if(![Link](sum)){
[Link](sum, i);
}
}

return max;
}

Program Creek 106 | 568


58 Subarray Sum Equals K
Given an array of integers and an integer k, find the total number of continuous subarrays whose sum equals to
k.
Example 1:
Input:nums = [1,1,1], k = 2 Output: 2
Note that empty array is not considered as a subarray.

58.1 Java Solution


The sum problems can often be solved by using a hash map efficiently.

public int subarraySum(int[] nums, int k) {


HashMap<Integer, Integer> map = new HashMap<>();
[Link](0, 1);

int count = 0;
int sum = 0;

//e.g., 1 1 2 1 1
for(int i=0; i<[Link]; i++){
sum += nums[i];
int n = [Link](sum-k, 0);
count += n;

[Link](sum, [Link](sum,0)+1);
}

return count;
}

107 | 568
59 Maximum Subarray
Find the contiguous subarray within an array (containing at least one number) which has the largest sum.
For example, given the array [−2,1,−3,4,−1,2,1,−5,4], the contiguous subarray [4,−1,2,1] has the largest sum =
6.

59.1 Java Solution 1 - DP


The easiest way to formulate the solution of this problem is using DP. Let f(n) be the maximum subarray for an
array with n elements. We need to find the subproblem and the relation.

f(n) = { f(n-1)>0 ? f(n-1) : 0 } + nums[n-1]

f(0) = 0
f(1) = nums[0]

The changing condition for dynamic programming is "We should ignore the sum of the previous n-1 elements
if nth element is greater than the sum."

public class Solution {


public int maxSubArray(int[] A) {
int max = A[0];
int[] sum = new int[[Link]];
sum[0] = A[0];

108 | 568
59 Maximum Subarray

for (int i = 1; i < [Link]; i++) {


sum[i] = [Link](A[i], sum[i - 1] + A[i]);
max = [Link](max, sum[i]);
}

return max;
}
}

The time complexity and space complexity are the same O(n). However, we can improve the space complexity
and make it to be O(1).

public int maxSubArray(int[] nums) {


//[-2,1,-3,4,-1,2,1,-5,4],
int result = nums[0];
int sum = nums[0];
for(int i=1; i<[Link]; i++){
if(sum<=0){
sum = nums[i];
}else{
sum += nums[i];
}
result = [Link](result, sum);
}

return result;
}

59.2 Java Solution 2 - Using Sum Diff


Like other array sum related problems, the target sum k can be expressed as sum-sum’:

public int maxSubArray(int[] nums) {


if(nums==null || [Link]==0){
return 0;
}

PriorityQueue<Integer> pre= new PriorityQueue<>();


[Link](0);

int sum = 0;

Program Creek 109 | 568


59 Maximum Subarray

int result = Integer.MIN_VALUE;

for(int i=0; i<[Link]; i++){


sum = sum+nums[i];
result = [Link](result, [Link]());
[Link](sum);
}

return result;
}

Time complexity is O(nLogn) and space complexity is O(n).

Program Creek 110 | 568


60 Maximum Product Subarray
Find the contiguous subarray within an array (containing at least one number) which has the largest product.
For example, given the array [2,3,-2,4], the contiguous subarray [2,3] has the largest product = 6.

60.1 Java Solution - Dynamic Programming


This is similar to maximum subarray. Instead of sum, the sign of number affect the product value.
When iterating the array, each element has two possibilities: positive number or negative number. We need to
track a minimum value, so that when a negative number is given, it can also find the maximum value. We define
two local variables, one tracks the maximum and the other tracks the minimum.

public int maxProduct(int[] nums) {


int[] max = new int[[Link]];
int[] min = new int[[Link]];

max[0] = min[0] = nums[0];


int result = nums[0];

for(int i=1; i<[Link]; i++){


if(nums[i]>0){
max[i]=[Link](nums[i], max[i-1]*nums[i]);
min[i]=[Link](nums[i], min[i-1]*nums[i]);
}else{
max[i]=[Link](nums[i], min[i-1]*nums[i]);
min[i]=[Link](nums[i], max[i-1]*nums[i]);
}

result = [Link](result, max[i]);


}

return result;
}

Time is O(n).

111 | 568
61 Longest Substring Without Repeating
Characters
Given a string, find the length of the longest substring without repeating characters. For example, the longest
substring without repeating letters for "abcabcbb" is "abc", which the length is 3. For "bbbbb" the longest substring
is "b", with the length of 1.

61.1 Analysis
The basic idea to solve this problem is using an extra data structure to track the unique characters in a sliding
window. Both an array and a hash set work for this purpose.

61.2 Java Solution 1


The first solution is like the problem of "determine if a string has all unique characters" in CC 150. We can use a
flag array to track the existing characters for the longest substring without repeating characters.

public int lengthOfLongestSubstring(String s) {


if(s==null)
return 0;
boolean[] flag = new boolean[256];

int result = 0;
int start = 0;
char[] arr = [Link]();

for (int i = 0; i < [Link]; i++) {


char current = arr[i];
if (flag[current]) {
result = [Link](result, i - start);
// the loop update the new start point
// and reset flag array
// for example, abccab, when it comes to 2nd c,
// it update start from 0 to 3, reset flag for a,b
for (int k = start; k < i; k++) {
if (arr[k] == current) {
start = k + 1;
break;
}
flag[arr[k]] = false;
}
} else {
flag[current] = true;
}
}

result = [Link]([Link] - start, result);

return result;

112 | 568
61 Longest Substring Without Repeating Characters

61.3 Java Solution 2 - HashSet


Using a HashSet can simplify the code a lot.

/*
pwwkew
i |
j |

i |
j |

i |
j |

*/
public int lengthOfLongestSubstring(String s) {
if(s==null||[Link]()==0){
return 0;
}

HashSet<Character> set = new HashSet<>();


int result = 1;
int i=0;
for(int j=0; j<[Link](); j++){
char c = [Link](j);
if(![Link](c)){
[Link](c);
result = [Link](result, [Link]());
}else{
while(i<j){
if([Link](i)==c){
i++;
break;
}

[Link]([Link](i));
i++;
}
}
}

return result;
}

Program Creek 113 | 568


62 Longest Substring with At Most K Distinct
Characters
This is a problem asked by Google.
Given a string, find the longest substring that contains only two unique characters. For example, given "abcbbb-
bcccbdddadacb", the longest substring that contains 2 unique character is "bcbbbbcccb".

62.1 Longest Substring Which Contains 2 Unique Characters


In this solution, a hashmap is used to track the unique elements in the map. When a third character is added to
the map, the left pointer needs to move right.
You can use "abac" to walk through this solution.

public int lengthOfLongestSubstringTwoDistinct(String s) {


int max=0;
HashMap<Character,Integer> map = new HashMap<Character, Integer>();
int start=0;

for(int i=0; i<[Link](); i++){


char c = [Link](i);
if([Link](c)){
[Link](c, [Link](c)+1);
}else{
[Link](c,1);
}

if([Link]()>2){
max = [Link](max, i-start);

while([Link]()>2){
char t = [Link](start);
int count = [Link](t);
if(count>1){
[Link](t, count-1);
}else{
[Link](t);
}
start++;
}
}
}

max = [Link](max, [Link]()-start);

return max;
}

Now if this question is extended to be "the longest substring that contains k unique characters", what should
we do?

114 | 568
62 Longest Substring with At Most K Distinct Characters

62.2 Solution for K Unique Characters


The following solution is corrected. Given "abcadcacacaca" and 3, it returns "cadcacacaca".

public int lengthOfLongestSubstringKDistinct(String s, int k) {


int result = 0;
int i=0;
HashMap<Character, Integer> map = new HashMap<Character, Integer>();

for(int j=0; j<[Link](); j++){


char c = [Link](j);
if([Link](c)){
[Link](c, [Link](c)+1);
}else{
[Link](c, 1);
}

if([Link]()<=k){
result = [Link](result, j-i+1);
}else{
while([Link]()>k){
char l = [Link](i);
int count = [Link](l);
if(count==1){
[Link](l);
}else{
[Link](l, [Link](l)-1);
}
i++;
}
}

return result;
}

Time is O(n).

Program Creek 115 | 568


63 Substring with Concatenation of All Words
You are given a string, s, and a list of words, words, that are all of the same length. Find all starting indices
of substring(s) in s that is a concatenation of each word in words exactly once and without any intervening
characters.
For example, given: s="barfoothefoobarman" & words=["foo", "bar"], return [0,9].

63.1 Analysis
This problem is similar (almost the same) to Longest Substring Which Contains 2 Unique Characters.
Since each word in the dictionary has the same length, each of them can be treated as a single character.

63.2 Java Solution

public List<Integer> findSubstring(String s, String[] words) {


ArrayList<Integer> result = new ArrayList<Integer>();
if(s==null||[Link]()==0||words==null||[Link]==0){
return result;
}

//frequency of words
HashMap<String, Integer> map = new HashMap<String, Integer>();
for(String w: words){
if([Link](w)){
[Link](w, [Link](w)+1);
}else{
[Link](w, 1);
}
}

int len = words[0].length();

for(int j=0; j<len; j++){


HashMap<String, Integer> currentMap = new HashMap<String, Integer>();
int start = j;//start index of start
int count = 0;//count totoal qualified words so far

for(int i=j; i<=[Link]()-len; i=i+len){


String sub = [Link](i, i+len);
if([Link](sub)){
//set frequency in current map
if([Link](sub)){
[Link](sub, [Link](sub)+1);
}else{
[Link](sub, 1);
}

count++;

116 | 568
63 Substring with Concatenation of All Words

while([Link](sub)>[Link](sub)){
String left = [Link](start, start+len);
[Link](left, [Link](left)-1);

count--;
start = start + len;
}

if(count==[Link]){
[Link](start); //add to result

//shift right and reset currentMap, count & start point


String left = [Link](start, start+len);
[Link](left, [Link](left)-1);
count--;
start = start + len;
}
}else{
[Link]();
start = i+len;
count = 0;
}
}
}

return result;
}

Program Creek 117 | 568


64 Minimum Window Substring
Given a string S and a string T, find the minimum window in S which will contain all the characters in T in
complexity O(n).
For example, S = "ADOBECODEBANC", T = "ABC", Minimum window is "BANC".

64.1 Java Solution

public String minWindow(String s, String t) {


HashMap<Character, Integer> goal = new HashMap<>();
int goalSize = [Link]();
int minLen = Integer.MAX_VALUE;
String result = "";

//target dictionary
for(int k=0; k<[Link](); k++){
[Link]([Link](k), [Link]([Link](k), 0)+1);
}

int i=0;
int total=0;
HashMap<Character, Integer> map = new HashMap<>();
for(int j=0; j<[Link](); j++){
char c = [Link](j);
if(![Link](c)){
continue;
}

//if c is a target character in the goal, and count is < goal, increase the total
int count = [Link](c, 0);
if(count<[Link](c)){
total++;
}

[Link](c, count+1);

//when total reaches the goal, trim from left until no more chars can be trimmed.
if(total==goalSize){
while(![Link]([Link](i)) || [Link]([Link](i))>[Link]([Link](i))){
char pc = [Link](i);
if([Link](pc) && [Link](pc)>[Link](pc)){
[Link](pc, [Link](pc)-1);
}

i++;
}

if(minLen>j-i+1){
minLen = j-i+1;
result = [Link](i, j+1);

118 | 568
64 Minimum Window Substring

}
}
}

return result;
}

Program Creek 119 | 568


65 Longest Substring with At Least K Repeating
Characters
Find the length of the longest substring T of a given string (consists of lowercase letters only) such that every
character in T appears no less than k times.
Example 1:

Input:
s = "aaabb", k = 3

Output:
3
The longest substring is "aaa", as ’a’ is repeated 3 times.

65.1 Java Solution


This problem can be solved using DFS. When all chars in the input string occurs >=k, return the length. But we
first need to split the input string by using the characters whose occurrence <k.

public int longestSubstring(String s, int k) {


HashMap<Character, Integer> counter = new HashMap<Character, Integer>();

for(int i=0; i<[Link](); i++){

char c = [Link](i);
if([Link](c)){
[Link](c, [Link](c)+1);
}else{
[Link](c, 1);
}

HashSet<Character> splitSet = new HashSet<Character>();


for(char c: [Link]()){
if([Link](c)<k){
[Link](c);
}
}

if([Link]()){
return [Link]();
}

int max = 0;
int i=0, j=0;
while(j<[Link]()){
char c = [Link](j);
if([Link](c)){

120 | 568
65 Longest Substring with At Least K Repeating Characters

if(j!=i){
max = [Link](max, longestSubstring([Link](i, j), k));
}
i=j+1;
}
j++;
}

if(i!=j)
max = [Link](max, longestSubstring([Link](i, j), k));

return max;
}

Program Creek 121 | 568


66 Permutation in String
Given two strings s1 and s2, write a function to return true if s2 contains the permutation of s1. In other words,
one of the first string’s permutations is the substring of the second string.
For example:

Input: s1 = "ab" s2 = "eidbaooo"


Output: True
Explanation: s2 contains one permutation of s1 ("ba").

66.1 Java Solution

public boolean checkInclusion(String s1, String s2) {


HashMap<Character, Integer> dict = new HashMap<>();
for (int i = 0; i < [Link](); i++) {
int feq = [Link]([Link](i), 0);
[Link]([Link](i), feq + 1);
}

HashMap<Character, Integer> temp = new HashMap<>();


int i = 0;
for (int j = 0; j < [Link](); j++) {
if (![Link]([Link](j))) {
i = j + 1;
[Link](); //clear counter
continue;
}

int count = [Link]([Link](j), 0);


if (count == 0 || count < [Link]([Link](j))) {
[Link]([Link](j), count + 1);

if (j - i + 1 == [Link]()) {
return true;
}
} else {
while (i < j) {
if ([Link](i) == [Link](j)) {
i++;
break;
}

[Link]([Link](i), [Link]([Link](i)) - 1);


i++;
}
}
}

return false;

122 | 568
66 Permutation in String

Program Creek 123 | 568


67 Longest Consecutive Sequence
Given an unsorted array of integers, find the length of the longest consecutive elements sequence.
For example, given [100, 4, 200, 1, 3, 2], the longest consecutive elements sequence should be [1, 2, 3, 4]. Its
length is 4.
Your algorithm should run in O(n) complexity.

67.1 Java Solution 1


Because it requires O(n) complexity, we can not solve the problem by sorting the array first. Sorting takes at least
O(nlogn) time.
We can use a HashSet to add and remove elements. HashSet is implemented by using a hash table. Elements
are not ordered. The add, remove and contains methods have constant time complexity O(1).

public static int longestConsecutive(int[] num) {


// if array is empty, return 0
if ([Link] == 0) {
return 0;
}

Set<Integer> set = new HashSet<Integer>();


int max = 1;

for (int e : num)


[Link](e);

for (int e : num) {


int left = e - 1;
int right = e + 1;
int count = 1;

while ([Link](left)) {
count++;
[Link](left);
left--;
}

while ([Link](right)) {
count++;
[Link](right);
right++;
}

max = [Link](count, max);


}

return max;
}

124 | 568
67 Longest Consecutive Sequence

67.2 Java Solution 2


We can also project the arrays to a new array with length to be the largest element in the array. Then iterate over
the array and get the longest consecutive sequence. If the largest number is very large, then the time complexity
would be bad.

Program Creek 125 | 568


68 Majority Element
Given an array of size n, find the majority element. The majority element is the element that appears more than
b n/2 c times. (assume that the array is non-empty and the majority element always exist in the array.)

68.1 Java Solution 1 - Sorting


Assuming the majority exists and since the majority always takes more than half of space, the middle element is
guaranteed to be the majority. Sorting array takes O(nlog(n)). So the time complexity of this solution is nlog(n).

public int majorityElement(int[] num) {


if ([Link] == 1) {
return num[0];
}

[Link](num);
return num[[Link] / 2];
}

68.2 Java Solution 2 - Majority Vote Algorithm


This problem can be solved in time of O(n) with constant space complexity. The basic idea is that the majority
element can negate all other element’s count.

public int majorityElement(int[] nums) {


int result = 0, count = 0;

for(int i = 0; i<[Link]; i++ ) {


if(count == 0){
result = nums[ i ];
count = 1;
}else if(result == nums[i]){
count++;
}else{
count--;
}
}

126 | 568
68 Majority Element

return result;
}

Program Creek 127 | 568


69 Majority Element II
Given an integer array of size n, find all elements that appear more than b n/3 c times. The algorithm should run
in linear time and in O(1) space.

69.1 Java Solution


This problem is similar to Majority Element I. Time = O(n) and Space = O(1).

public List<Integer> majorityElement(int[] nums) {


List<Integer> result = new ArrayList<Integer>();

Integer n1=null, n2=null;


int c1=0, c2=0;

for(int i: nums){
if(n1!=null && i==[Link]()){
c1++;
}else if(n2!=null && i==[Link]()){
c2++;
}else if(c1==0){
c1=1;
n1=i;
}else if(c2==0){
c2=1;
n2=i;
}else{
c1--;
c2--;
}
}

c1=c2=0;

for(int i: nums){
if(i==[Link]()){
c1++;
}else if(i==[Link]()){
c2++;
}
}

if(c1>[Link]/3)
[Link](n1);
if(c2>[Link]/3)
[Link](n2);

return result;
}

128 | 568
70 Increasing Triplet Subsequence
Given an unsorted array return whether an increasing subsequence of length 3 exists or not in the array.
Examples: Given [1, 2, 3, 4, 5], return true.
Given [5, 4, 3, 2, 1], return false.

70.1 Analysis
This problem can be formalized as finding a sequence x, y and z, such that x <y <z .

70.2 Java Solution

public boolean increasingTriplet(int[] nums) {


int x = Integer.MAX_VALUE;
int y = Integer.MAX_VALUE;

for (int i = 0; i < [Link]; i++) {


int z = nums[i];

if (x >= z) {
x = z;// update x to be a smaller value
} else if (y >= z) {
y = z; // update y to be a smaller value
} else {
return true;
}
}

return false;

129 | 568
70 Increasing Triplet Subsequence

Program Creek 130 | 568


71 Find the Second Largest Number in an Array

71.1 Problem
Given an integer array, find the second largest number in the array.

71.2 Solution
The optimal time is linear to the length of the array N. We can iterate over the array, whenever the largest elements
get updated, its current value becomes the second largest.

public static int getSecondLargest(int[] arr){


int first = Integer.MIN_VALUE;
int second = Integer.MIN_VALUE;

for(int i=0; i<[Link]; i++){


if(arr[i]>first){
second=first;
first=arr[i];
}
}

return second;
}

131 | 568
72 Word Ladder
Given two words (start and end), and a dictionary, find the length of shortest transformation sequence from start
to end, such that only one letter can be changed at a time and each intermediate word must exist in the dictionary.
For example, given:

start = "hit"
end = "cog"
dict = ["hot","dot","dog","lot","log"]

One shortest transformation is "hit" ->"hot" ->"dot" ->"dog" ->"cog", the program should return its length 5.

72.1 Java Solution


This is a search problem, and breath-first search guarantees the optimal solution.

class WordNode{
String word;
int numSteps;

public WordNode(String word, int numSteps){


[Link] = word;
[Link] = numSteps;
}
}

public class Solution {


public int ladderLength(String beginWord, String endWord, Set<String> wordDict) {
LinkedList<WordNode> queue = new LinkedList<WordNode>();
[Link](new WordNode(beginWord, 1));

[Link](endWord);

while(![Link]()){
WordNode top = [Link]();
String word = [Link];

if([Link](endWord)){

132 | 568
72 Word Ladder

return [Link];
}

char[] arr = [Link]();


for(int i=0; i<[Link]; i++){
for(char c=’a’; c<=’z’; c++){
char temp = arr[i];
if(arr[i]!=c){
arr[i]=c;
}

String newWord = new String(arr);


if([Link](newWord)){
[Link](new WordNode(newWord, [Link]+1));
[Link](newWord);
}

arr[i]=temp;
}
}
}

return 0;
}
}

Program Creek 133 | 568


73 Word Ladder II
Given two words (start and end), and a dictionary, find all shortest transformation sequence(s) from start to end,
such that: 1) Only one letter can be changed at a time, 2) Each intermediate word must exist in the dictionary.
For example, given: start = "hit", end = "cog", and dict = ["hot","dot","dog","lot","log"], return:

[
["hit","hot","dot","dog","cog"],
["hit","hot","lot","log","cog"]
]

73.1 Java Solution


This is an extension of Word Ladder. The idea is the same. To track the actual ladder, we need to add a pointer
that points to the previous node in the WordNode class. In addition, the used word can not directly removed
from the dictionary. The used word is only removed when steps change.

class Solution {

public List<List<String>> findLadders(String beginWord, String endWord, List<String> wordList) {


List<List<String>> result = new ArrayList<List<String>>();

HashSet<String> unvisited = new HashSet<>();


[Link](wordList);

LinkedList<Node> queue = new LinkedList<>();


Node node = new Node(beginWord,0,null);
[Link](node);

int minLen = Integer.MAX_VALUE;


while(![Link]()){
Node top = [Link]();

//top if have shorter result already


if([Link]()>0 && [Link]>minLen){
return result;
}

for(int i=0; i<[Link](); i++){


char c = [Link](i);
char[] arr = [Link]();
for(char j=’z’; j>=’a’; j--){
if(j==c){
continue;
}
arr[i]=j;
String t = new String(arr);

if([Link](endWord)){
//add to result

134 | 568
73 Word Ladder II

List<String> aResult = new ArrayList<>();


[Link](endWord);
Node p = top;
while(p!=null){
[Link]([Link]);
p = [Link];
}

[Link](aResult);
[Link](aResult);

//stop if get shorter result


if([Link]<=minLen){
minLen=[Link];
}else{
return result;
}
}

if([Link](t)){
Node n=new Node(t,[Link]+1,top);
[Link](n);
[Link](t);
}
}
}
}

return result;
}
}

class Node{
public String word;
public int depth;
public Node prev;

public Node(String word, int depth, Node prev){


[Link]=word;
[Link]=depth;
[Link]=prev;
}
}

Program Creek 135 | 568


74 Top K Frequent Elements
Given a non-empty array of integers, return the k most frequent elements.

74.1 Java Solution 1 - Heap


Time complexity is O(n*log(k)). Note that heap is often used to reduce time complexity from n*log(n) (see solution
3) to n*log(k).

class Pair{
int num;
int count;
public Pair(int num, int count){
[Link]=num;
[Link]=count;
}
}

class Solution {
public List<Integer> topKFrequent(int[] nums, int k) {
//count the frequency for each element
HashMap<Integer, Integer> map = new HashMap<>();
for(int num: nums){
if([Link](num)){
[Link](num, [Link](num)+1);
}else{
[Link](num, 1);
}
}

// create a min heap


PriorityQueue<Pair> queue = new PriorityQueue<>([Link](Pair->[Link]));

//maintain a heap of size k.


for([Link]<Integer, Integer> entry: [Link]()){
Pair p = new Pair([Link](), [Link]());
[Link](p);
if([Link]()>k){
[Link]();
}
}

//get all elements from the heap


List<Integer> result = new ArrayList<>();
while([Link]()>0){
[Link]([Link]().num);
}

//reverse the order


[Link](result);

136 | 568
74 Top K Frequent Elements

return result;
}
}

74.2 Java Solution 2 - Bucket Sort


Time is O(n).

public List<Integer> topKFrequent(int[] nums, int k) {


//count the frequency for each element
HashMap<Integer, Integer> map = new HashMap<Integer, Integer>();
for(int num: nums){
if([Link](num)){
[Link](num, [Link](num)+1);
}else{
[Link](num, 1);
}
}

//get the max frequency


int max = 0;
for([Link]<Integer, Integer> entry: [Link]()){
max = [Link](max, [Link]());
}

//initialize an array of ArrayList. index is frequency, value is list of numbers


ArrayList<Integer>[] arr = (ArrayList<Integer>[]) new ArrayList[max+1];
for(int i=1; i<=max; i++){
arr[i]=new ArrayList<Integer>();
}

for([Link]<Integer, Integer> entry: [Link]()){


int count = [Link]();
int number = [Link]();
arr[count].add(number);
}

List<Integer> result = new ArrayList<Integer>();

//add most frequent numbers to result


for(int j=max; j>=1; j--){
if(arr[j].size()>0){
for(int a: arr[j]){
[Link](a);
//if size==k, stop
if([Link]()==k){
break;
}
}
}
}

return result;
}

Program Creek 137 | 568


74 Top K Frequent Elements

74.3 Java Solution 3 - A Regular Counter (Deprecated)


We can solve this problem by using a regular counter, and then sort the counter by value.

public class Solution {


public List<Integer> topKFrequent(int[] nums, int k) {
List<Integer> result = new ArrayList<Integer>();

HashMap<Integer, Integer> counter = new HashMap<Integer, Integer>();

for(int i: nums){
if([Link](i)){
[Link](i, [Link](i)+1);
}else{
[Link](i, 1);
}
}

TreeMap<Integer, Integer> sortedMap = new TreeMap<Integer, Integer>(new ValueComparator(counter));


[Link](counter);

int i=0;
for([Link]<Integer, Integer> entry: [Link]()){
[Link]([Link]());
i++;
if(i==k)
break;
}

return result;
}
}

class ValueComparator implements Comparator<Integer>{


HashMap<Integer, Integer> map = new HashMap<Integer, Integer>();

public ValueComparator(HashMap<Integer, Integer> m){


[Link](m);
}

public int compare(Integer i1, Integer i2){


int diff = [Link](i2)-[Link](i1);

if(diff==0){
return 1;
}else{
return diff;
}
}
}

Program Creek 138 | 568


75 Meeting Rooms II
Given an array of meeting time intervals consisting of start and end times [[s1,e1],[s2,e2],...] find the minimum
number of conference rooms required.

75.1 Java Solution


The basic idea of the solution is that we sequentially assign meeting to a room. We use a min heap to track the
earliest ending meeting. Whenever an old meeting ends before a new meeting starts, we remove the old meeting.
Otherwise, we need an extra room.

public int minMeetingRooms(Interval[] intervals) {


if(intervals==null||[Link]==0){
return 0;
}

Comparator<Interval> comp = [Link]((Interval i)->[Link]);


[Link](intervals, comp);

PriorityQueue<Integer> queue = new PriorityQueue<>();


[Link](intervals[0].end);
int count = 1;
for(int i=1; i<[Link]; i++){
int head = [Link]();
if(intervals[i].start>=head){
[Link]();
}else{
count++;
}
[Link](intervals[i].end);
}

return count;
}

There was a discussion in the comment about why a regular queue is not good enough. I draw an example
below to show why sorting based on start time and using a priority queue is necessary.

139 | 568
75 Meeting Rooms II

Program Creek 140 | 568


76 Meeting Rooms
Given an array of meeting time intervals consisting of start and end times [s1, e1], [s2, e2], ... , determine if a
person could attend all meetings.
For example, Given [ [0, 30], [5, 10], [15, 20] ], return false.

76.1 Java Solution


If a person can attend all meetings, there must not be any overlaps between any meetings. After sorting the
intervals, we can compare the current end and next start.

public boolean canAttendMeetings(Interval[] intervals) {


[Link](intervals, new Comparator<Interval>(){
public int compare(Interval a, Interval b){
return [Link];
}
});

for(int i=0; i<[Link]-1; i++){


if(intervals[i].end>intervals[i+1].start){
return false;
}
}

return true;
}

141 | 568
77 Range Addition
Assume you have an array of length n initialized with all 0’s and are given k update operations.
Each operation is represented as a triplet: [startIndex, endIndex, inc] which increments each element of subar-
ray A[startIndex ... endIndex] (startIndex and endIndex inclusive) with inc.
Return the modified array after all k operations were executed.
For example, Input: length = 5, updates = [[1,3,2],[2,4,3],[0,2,-2]] Output: [-2,0,3,5,3]

77.1 Java Solution 1 - heap

public int[] getModifiedArray(int length, int[][] updates) {


int result[] = new int[length];
if(updates==null || [Link]==0)
return result;

//sort updates by starting index


[Link](updates, new Comparator<int[]>(){
public int compare(int[] a, int [] b){
return a[0]-b[0];
}
});

ArrayList<int[]> list = new ArrayList<int[]>();

//create a heap sorted by ending index


PriorityQueue<Integer> queue = new PriorityQueue<Integer>(new Comparator<Integer>(){
public int compare(Integer a, Integer b){
return updates[a][1]-updates[b][1];
}
});

int sum=0;
int j=0;
for(int i=0; i<length; i++){
//substract value from sum when ending index is reached
while(![Link]() && updates[[Link]()][1] < i){
int top = [Link]();
sum -= updates[top][2];
}

//add value to sum when starting index is reached


while(j<[Link] && updates[j][0] <= i){
sum = sum+updates[j][2];
[Link](j);
j++;
}

result[i]=sum;
}

142 | 568
77 Range Addition

return result;
}

Time complexity is O(nlog(n)).

77.2 Java Solution 2


We can track each range’s start and end when iterating over the ranges. And in the final result array, adjust the
values on the change points. The following shows an example:

public int[] getModifiedArray(int length, int[][] updates) {


int[] result = new int[length];
if(updates==null||[Link]==0)
return result;

for(int i=0; i<[Link]; i++){


result[updates[i][0]] += updates[i][2];
if(updates[i][1]<length-1){
result[updates[i][1]+1] -=updates[i][2];
}
}

int v=0;
for(int i=0; i<length; i++){
v += result[i];
result[i]=v;
}

return result;
}

Time complexity is O(n).

Program Creek 143 | 568


78 Merge K Sorted Arrays in Java
This is a classic interview question. Another similar problem is "merge k sorted lists".
This problem can be solved by using a heap. The time complexity is O(nlog(k)), where n is the total number of
elements and k is the number of arrays.
It takes O(log(k)) to insert an element to the heap and it takes O(log(k)) to delete the minimum element.

class ArrayContainer implements Comparable<ArrayContainer> {


int[] arr;
int index;

public ArrayContainer(int[] arr, int index) {


[Link] = arr;
[Link] = index;
}

@Override
public int compareTo(ArrayContainer o) {
return [Link][[Link]] - [Link][[Link]];
}
}

public class KSortedArray {


public static int[] mergeKSortedArray(int[][] arr) {
//PriorityQueue is heap in Java
PriorityQueue<ArrayContainer> queue = new PriorityQueue<ArrayContainer>();
int total=0;

//add arrays to heap


for (int i = 0; i < [Link]; i++) {
[Link](new ArrayContainer(arr[i], 0));
total = total + arr[i].length;
}

int m=0;
int result[] = new int[total];

//while heap is not empty


while(![Link]()){
ArrayContainer ac = [Link]();
result[m++]=[Link][[Link]];

if([Link] < [Link]-1){


[Link](new ArrayContainer([Link], [Link]+1));
}
}

return result;
}

public static void main(String[] args) {

144 | 568
78 Merge K Sorted Arrays in Java

int[] arr1 = { 1, 3, 5, 7 };
int[] arr2 = { 2, 4, 6, 8 };
int[] arr3 = { 0, 9, 10, 11 };

int[] result = mergeKSortedArray(new int[][] { arr1, arr2, arr3 });


[Link]([Link](result));
}
}

Program Creek 145 | 568


79 Merge k Sorted Lists
Merge k sorted linked lists and return it as one sorted list. Analyze and describe its complexity.

79.1 Analysis
The simplest solution is using PriorityQueue. The elements of the priority queue are ordered according to their
natural ordering, or by a comparator provided at the construction time (in this case).

79.2 Java Solution

public ListNode mergeKLists(ListNode[] lists) {


if(lists==null||[Link]==0)
return null;

PriorityQueue<ListNode> queue = new PriorityQueue<ListNode>(new Comparator<ListNode>(){


public int compare(ListNode l1, ListNode l2){
return [Link] - [Link];
}
});

ListNode head = new ListNode(0);


ListNode p = head;

for(ListNode list: lists){


if(list!=null)
[Link](list);
}

while(![Link]()){
ListNode n = [Link]();
[Link] = n;
p=[Link];

if([Link]!=null)
[Link]([Link]);
}

return [Link];

Time: log(k) * n. k is number of list and n is number of total elements.


In addition, from Java 8 comparator definition can be simplified as the following:

Comparator<ListNode> comp = [Link](ListNode->[Link]);


PriorityQueue<ListNode> queue = new PriorityQueue<>(comp);

146 | 568
80 Rearrange String k Distance Apart
Given a non-empty string str and an integer k, rearrange the string such that the same characters are at least
distance k from each other.
All input strings are given in lowercase letters. If it is not possible to rearrange the string, return an empty
string "".
Example:

str = "aabbcc", k = 3

Result: "abcabc"

The same letters are at least distance 3 from each other.

80.1 Java Solution

public String rearrangeString(String str, int k) {


if(k==0)
return str;

//initialize the counter for each character


final HashMap<Character, Integer> map = new HashMap<Character, Integer>();
for(int i=0; i<[Link](); i++){
char c = [Link](i);
if([Link](c)){
[Link](c, [Link](c)+1);
}else{
[Link](c, 1);
}
}

//sort the chars by frequency


PriorityQueue<Character> queue = new PriorityQueue<Character>(new Comparator<Character>(){
public int compare(Character c1, Character c2){
if([Link](c2).intValue()!=[Link](c1).intValue()){
return [Link](c2)-[Link](c1);
}else{
return [Link](c2);
}
}
});

for(char c: [Link]())
[Link](c);

StringBuilder sb = new StringBuilder();

int len = [Link]();

147 | 568
80 Rearrange String k Distance Apart

while(![Link]()){

int cnt = [Link](k, len);


ArrayList<Character> temp = new ArrayList<Character>();

for(int i=0; i<cnt; i++){


if([Link]())
return "";

char c = [Link]();
[Link]([Link](c));

[Link](c, [Link](c)-1);

if([Link](c)>0){
[Link](c);
}

len--;
}

for(char c: temp)
[Link](c);
}

return [Link]();
}

Program Creek 148 | 568


81 Minimum Cost to Hire K Workers
There are N workers. The i-th worker has a quality[i] and a minimum wage expectation wage[i].
Now we want to hire exactly K workers to form a paid group. When hiring a group of K workers, we must
pay them according to the following rules: Every worker in the paid group should be paid in the ratio of their
quality compared to other workers in the paid group. Every worker in the paid group must be paid at least their
minimum wage expectation. Return the least amount of money needed to form a paid group satisfying the above
conditions.
Example:

Input: quality = [10,20,5], wage = [70,50,30], K = 2


Output: 105.00000
Explanation: We pay 70 to 0-th worker and 35 to 2-th worker.

81.1 Java Solution


First, sort workers by their wage/quality ratio in ascending order. The smaller ratio value means better quality
and low wage. Then try the best ratio first and use the heap to track the largest quality. Given a ratio, the largest
quality is removed from the queue because it takes more wage.

class Solution {
public double mincostToHireWorkers(int[] quality, int[] wage, int K) {
ArrayList<Worker> list = new ArrayList<>();
for(int i=0; i<[Link]; i++){
[Link](new Worker(quality[i], wage[i]));
}
Comparator<Worker> comp = [Link]((Worker w) -> [Link]);
[Link](list, comp);

PriorityQueue<Integer> q = new PriorityQueue<>();


int sum = 0;
double result = Integer.MAX_VALUE;

for(int i=0; i<[Link](); i++){


Worker w = [Link](i);
sum += [Link];
[Link](-[Link]);

if([Link]()>K){
int extra = [Link]();
sum += extra;
}

if([Link]() == K){
result = [Link](result, sum * [Link]);
}
}

return result;
}

149 | 568
81 Minimum Cost to Hire K Workers

class Worker{
int quality;
int wage;
double ratio;

public Worker(int q, int w){


[Link] = q;
[Link] = w;
[Link] = (double)w/q;
}
}

Program Creek 150 | 568


82 Contains Duplicate
Given an array of integers, find if the array contains any duplicates. Your function should return true if any value
appears at least twice in the array, and it should return false if every element is distinct.

82.1 Java Solution

public boolean containsDuplicate(int[] nums) {


if(nums==null || [Link]==0)
return false;

HashSet<Integer> set = new HashSet<Integer>();


for(int i: nums){
if(![Link](i)){
return true;
}
}

return false;
}

151 | 568
83 Contains Duplicate II
Given an array of integers and an integer k, return true if and only if there are two distinct indices i and j in the
array such that nums[i] = nums[j] and the difference between i and j is at most k.

83.1 Java Solution 1 - HashMap

public boolean containsNearbyDuplicate(int[] nums, int k) {


HashMap<Integer, Integer> map = new HashMap<Integer, Integer>();

for(int i=0; i<[Link]; i++){


if([Link](nums[i])){
int pre = [Link](nums[i]);
if(i-pre<=k)
return true;
}

[Link](nums[i], i);
}

return false;
}

83.2 Java Solution 2 - HashSet

public boolean containsNearbyDuplicate(int[] nums, int k) {


if(nums==null || [Link]<2 || k==0)
return false;

int i=0;

HashSet<Integer> set = new HashSet<Integer>();

for(int j=0; j<[Link]; j++){


if(![Link](nums[j])){
return true;
}

if([Link]()>=k+1){
[Link](nums[i++]);
}
}

return false;
}

152 | 568
84 Contains Duplicate III
Given an array of integers, find out whether there are two distinct indices i and j in the array such that the
difference between nums[i] and nums[j] is at most t and the difference between i and j is at most k.

84.1 Java Solution 1 - Simple


This solution simple. Its time complexity is O(nlog(k)).

public boolean containsNearbyAlmostDuplicate(int[] nums, int k, int t) {


if(nums==null||[Link]<2||k<0||t<0)
return false;

TreeSet<Long> set = new TreeSet<Long>();


for(int i=0; i<[Link]; i++){
long curr = (long) nums[i];

long leftBoundary = (long) curr-t;


long rightBoundary = (long) curr+t+1; //right boundary is exclusive, so +1
SortedSet<Long> sub = [Link](leftBoundary, rightBoundary);
if([Link]()>0)
return true;

[Link](curr);

if(i>=k){ // or if([Link]()>=k+1)
[Link]((long)nums[i-k]);
}
}

return false;
}

84.2 Java Solution 2 - Deprecated

public boolean containsNearbyAlmostDuplicate(int[] nums, int k, int t) {


if (k < 1 || t < 0)

153 | 568
84 Contains Duplicate III

return false;

TreeSet<Integer> set = new TreeSet<Integer>();

for (int i = 0; i < [Link]; i++) {


int c = nums[i];
if (([Link](c) != null && c <= [Link](c) + t)
|| ([Link](c) != null && c >= [Link](c) -t))
return true;

[Link](c);

if (i >= k)
[Link](nums[i - k]);
}

return false;
}

Program Creek 154 | 568


85 Max Sum of Rectangle No Larger Than K
Given a non-empty 2D matrix matrix and an integer k, find the max sum of a rectangle in the matrix such that its
sum is no larger than k.
Example:

Given matrix = [
[1, 0, 1],
[0, -2, 3]
]
k = 2

The answer is 2. Because the sum of rectangle [[0, 1], [-2, 3]] is 2 and 2 is the max number no larger than k (k =
2).
Note: The rectangle inside the matrix must have an area >0. What if the number of rows is much larger than
the number of columns?

85.1 Analysis
We can solve this problem by comparing each submatrix. This method is trivial and we need a better solution.
The key to the optimal solution is using a tree set to calculate the maximum sum of subarray close to k.

85.2 Java Solution 1

public int maxSumSubmatrix(int[][] matrix, int k) {


if(matrix==null||[Link]==0||matrix[0].length==0)
return 0;

int m=[Link];
int n=matrix[0].length;

int result = Integer.MIN_VALUE;

for(int c1=0; c1<n; c1++){


int[] each = new int[m];
for(int c2=c1; c2>=0; c2--){

for(int r=0; r<m; r++){


each[r]+=matrix[r][c2];
}

result = [Link](result, getLargestSumCloseToK(each, k));


}
}

return result;
}

public int getLargestSumCloseToK(int[] arr, int k){

155 | 568
85 Max Sum of Rectangle No Larger Than K

int sum=0;
TreeSet<Integer> set = new TreeSet<Integer>();
int result=Integer.MIN_VALUE;
[Link](0);

for(int i=0; i<[Link]; i++){


sum=sum+arr[i];

Integer ceiling = [Link](sum-k);


if(ceiling!=null){
result = [Link](result, sum-ceiling);
}

[Link](sum);
}

return result;
}

The time complexity is O(n*n*m*log(m)). If m is greater than n, this solution is fine. However, if m is less than
n, then this solution is not optimal. In this case, we should reverse the row and column, like Solution 2.

85.3 Java Solution 2

public int maxSumSubmatrix(int[][] matrix, int k) {


if(matrix==null||[Link]==0||matrix[0].length==0)
return 0;

int row=[Link];
int col=matrix[0].length;

int m = [Link](row, col);


int n = [Link](row, col);
boolean isRowLarger = false;
if(row>col)
isRowLarger=true;

int result = Integer.MIN_VALUE;

for(int c1=0; c1<n; c1++){

int[] each = new int[m];


for(int c2=c1; c2>=0; c2--){

for(int r=0; r<m; r++){


each[r]+=isRowLarger?matrix[r][c2]:matrix[c2][r];
}

result = [Link](result, getLargestSumCloseToK(each, k));


}
}

return result;
}

public int getLargestSumCloseToK(int[] arr, int k){

Program Creek 156 | 568


85 Max Sum of Rectangle No Larger Than K

int sum=0;
TreeSet<Integer> set = new TreeSet<Integer>();
int result=Integer.MIN_VALUE;
[Link](0);

for(int i=0; i<[Link]; i++){


sum=sum+arr[i];

Integer ceiling = [Link](sum-k);


if(ceiling!=null){
result = [Link](result, sum-ceiling);
}

[Link](sum);
}

return result;
}

Program Creek 157 | 568


86 Maximum Sum of Subarray Close to K
Given an array, find the maximum sum of subarray close to k but not larger than k.

86.1 Java Solution


The solution to this problem is obvious when we draw the following diagram.

public int getLargestSumCloseToK(int[] arr, int k){


int sum=0;
TreeSet<Integer> set = new TreeSet<Integer>();
int result=Integer.MIN_VALUE;

158 | 568
86 Maximum Sum of Subarray Close to K

[Link](0);

for(int i=0; i<[Link]; i++){


sum=sum+arr[i];

Integer ceiling = [Link](sum-k);


if(ceiling!=null){
result = [Link](result, sum-ceiling);
}

[Link](sum);
}

return result;
}

Program Creek 159 | 568


87 Sliding Window Maximum
Given an array nums, there is a sliding window of size k which is moving from the very left of the array to the
very right. You can only see the k numbers in the window. Each time the sliding window moves right by one
position.

87.1 Java Solution

public int[] maxSlidingWindow(int[] nums, int k) {


if(nums==null||[Link]==0)
return new int[0];

int[] result = new int[[Link]-k+1];

LinkedList<Integer> deque = new LinkedList<Integer>();


for(int i=0; i<[Link]; i++){

160 | 568
87 Sliding Window Maximum

if(![Link]()&&[Link]()==i-k)
[Link]();

while(![Link]()&&nums[[Link]()]<nums[i]){
[Link]();
}

[Link](i);

if(i+1>=k)
result[i+1-k]=nums[[Link]()];
}

return result;
}

Program Creek 161 | 568


88 Moving Average from Data Stream
Given a stream of integers and a window size, calculate the moving average of all integers in the sliding window.

88.1 Java Solution


This problem is solved by using a queue.

class MovingAverage {
double sum;
int size;
LinkedList<Integer> list;

/** Initialize your data structure here. */


public MovingAverage(int size) {
[Link] = new LinkedList<>();
[Link] = size;
}

public double next(int val) {


sum += val;
[Link](val);

if([Link]()<=size){
return sum/[Link]();
}

sum -= [Link]();

return sum/size;
}
}

162 | 568
89 Find Median from Data Stream
Median is the middle value in an ordered integer list. If the size of the list is even, there is no middle value. So
the median is the mean of the two middle value.

89.1 Analysis
First of all, it seems that the best time complexity we can get for this problem is O(log(n)) of add() and O(1) of
getMedian(). This data structure seems highly likely to be a tree.
We can use heap to solve this problem. In Java, the PriorityQueue class is a priority heap. We can use two
heaps to store the lower half and the higher half of the data stream. The size of the two heaps differs at most 1.

163 | 568
89 Find Median from Data Stream

class MedianFinder {
PriorityQueue<Integer> minHeap = null;
PriorityQueue<Integer> maxHeap = null;

/** initialize your data structure here. */


public MedianFinder() {
minHeap = new PriorityQueue<>();
maxHeap = new PriorityQueue<>([Link]());
}

public void addNum(int num) {


[Link](num);
[Link]([Link]());

if([Link]()<[Link]()){
[Link]([Link]());
}
}

public double findMedian() {


if([Link]() > [Link]()){
return [Link]();
}else {
return ([Link]()+[Link]())/2.0;
}
}
}

Program Creek 164 | 568


90 Data Stream as Disjoint Intervals
Given a data stream input of non-negative integers a1, a2, ..., an, ..., summarize the numbers seen so far as a list
of disjoint intervals.
For example, suppose the integers from the data stream are 1, 3, 7, 2, 6, ..., then the summary will be:
[1, 1] [1, 1], [3, 3] [1, 1], [3, 3], [7, 7] [1, 3], [7, 7] [1, 3], [6, 7] Follow up: What if there are lots of merges and the
number of disjoint intervals are small compared to the data stream’s size?

90.1 Analysis
We can store the interval in an array and each time iterator over the array and merge the new value to an existing
interval. This takes time O(n). If there are a lot of merges, we want to do it in log(n).
We can solve this problem using a tree set. The floor() method returns the greatest element in this set less than
or equal to the given element, or null if there is no such element. The higher() method returns the least element in
this set strictly greater than the given element, or null if there is no such element. Note: we use higher() instead
of ceiling() to exclude the given element.

90.2 Java Solution

public class SummaryRanges {

TreeSet<Interval> set;

/** Initialize your data structure here. */


public SummaryRanges() {
set = new TreeSet<Interval>(new Comparator<Interval>(){
public int compare(Interval a, Interval b){
return [Link];
}
});
}

public void addNum(int val) {


Interval t = new Interval(val, val);

Interval floor = [Link](t);


if(floor!=null){
if(val<=[Link]){
return;
}else if(val == [Link]+1){
[Link] = [Link];
[Link](floor);
}
}

Interval ceil = [Link](t);


if(ceil!=null){
if([Link]==val+1){
[Link] = [Link];

165 | 568
90 Data Stream as Disjoint Intervals

[Link](ceil);
}
}

[Link](t);
}

public List<Interval> getIntervals() {


return new ArrayList(set);
//[Link]([Link](new Interval[0]));
}
}

Program Creek 166 | 568


91 Linked List Random Node
Given a singly linked list, return a random node’s value from the linked list. Each node must have the same
probability of being chosen.
Follow up: What if the linked list is extremely large and its length is unknown to you? Could you solve this
efficiently without using extra space?

91.1 Java Solution


This problem is trivial, so I focus on the follow-up problem.
We want the probability of being chosen is 1/count.
Given a list 1 ->2 ->3 ->4 ->5 ->... ->n, the only time we can possibly select the third node is when the pointer
points to 3. The probability of selecting the third node is 1/3 * 3/4 * 4/5 * ... * (n-1)/n = 1/n.

public class Solution {

/** @param head The linked list’s head. Note that the head is guanranteed to be not null, so it
contains at least one node. */
Random r=null;
ListNode h=null;
public Solution(ListNode head) {
r = new Random();
h = head;
}

/** Returns a random node’s value. */


public int getRandom() {
int count=1;
ListNode p = h;
int result = 0;
while(p!=null){
if([Link](count)==0)
result= [Link];
count++;
p = [Link];
}
return result;
}
}

167 | 568
92 Shuffle an Array
Shuffle a set of numbers without duplicates.

92.1 Java Solution


How we make sure each the probability of each element get shuffled is very similar to the streaming random
problem.
The algorithm is straightforward to understand, but the question is why it works. To have a working shuffle
algorithm, every element in the array results in each position should be equal.

class Solution {
int[] original = null;
int[] shuffle = null;
Random rand = null;

public Solution(int[] nums) {


original = nums;
shuffle = [Link](nums, [Link]);

168 | 568
92 Shuffle an Array

rand = new Random();


}

/** Resets the array to its original configuration and return it. */
public int[] reset() {
shuffle = [Link](original, [Link]);
return shuffle;
}

/** Returns a random shuffling of the array. */


public int[] shuffle() {
for(int i=0; i<[Link]; i++){
int x = [Link]([Link]-i);
int idx = x+i;

int tmp = shuffle[idx];


shuffle[idx] = shuffle[i];
shuffle[i] = tmp;
}

return shuffle;
}
}

Program Creek 169 | 568


93 Sort List
LeetCode - Sort List:
Sort a linked list in O(n log n) time using constant space complexity.

93.1 Analysis
If this problem does not have the constant space limitation, we can easily sort using a sorting method from Java
SDK. With the constant space limitation, we need to do some pointer manipulation.
• Break the list to two in the middle
• Recursively sort the two sub lists
• Merge the two sub lists

93.2 Java Solution


When I revisit this problem in 2018, I wrote it the following way which is more concise.

/**
* Definition for singly-linked list.
* public class ListNode {
* int val;
* ListNode next;
* ListNode(int x) { val = x; }
* }
*/
class Solution {
public ListNode sortList(ListNode head) {
if(head==null || [Link]==null){
return head;
}

//partition the list


ListNode p1 = head;
ListNode firstEnd = getFirstEnd(head);
ListNode p2 = [Link];
[Link] = null;

//sort each list


p1 = sortList(p1);
p2 = sortList(p2);

//merge two lists


return merge(p1, p2);
}

//get the list partition point


private ListNode getFirstEnd(ListNode head){
ListNode p1 = head;
ListNode p2 = head;

170 | 568
93 Sort List

while(p1!=null && p2!=null){


if([Link]==null||[Link]==null){
return p1;
}

p1 = [Link];
p2 = [Link];
}

return head;
}

//merge two list


private ListNode merge(ListNode n1, ListNode n2){
ListNode head = new ListNode(0);
ListNode p = head;
ListNode p1 = n1;
ListNode p2 = n2;
while(p1!=null && p2!=null){
if([Link]<[Link]){
[Link] = p1;
p1 = [Link];
}else{
[Link] = p2;
p2 = [Link];
}

p = [Link];
}

if(p1!=null){
[Link] = p1;
}

if(p2!=null){
[Link] = p2;
}

return [Link];
}
}

Program Creek 171 | 568


94 Quicksort Array in Java
Quicksort is a divide and conquer algorithm. It first divides a large list into two smaller sub-lists and then
recursively sort the two sub-lists. If we want to sort an array without any extra space, quicksort is a good option.
On average, time complexity is O(n log(n)).
The basic step of sorting an array are as follows:

• Select a pivot
• Move smaller elements to the left and move bigger elements to the right of the pivot
• Recursively sort left part and right part

This post shows two versions of the Java implementation. The first one picks the rightmost element as the pivot
and the second one picks the middle element as the pivot.

94.1 Version 1: Rightmost element as pivot


The following is the Java Implementation using rightmost element as the pivot.

public class QuickSort {

public static void main(String[] args) {


int[] arr = {4, 5, 1, 2, 3, 3};
quickSort(arr, 0, [Link]-1);
[Link]([Link](arr));
}

public static void quickSort(int[] arr, int start, int end){

int partition = partition(arr, start, end);

if(partition-1>start) {
quickSort(arr, start, partition - 1);
}
if(partition+1<end) {
quickSort(arr, partition + 1, end);
}
}

public static int partition(int[] arr, int start, int end){


int pivot = arr[end];

for(int i=start; i<end; i++){


if(arr[i]<pivot){
int temp= arr[start];
arr[start]=arr[i];
arr[i]=temp;
start++;
}
}

int temp = arr[start];

172 | 568
94 Quicksort Array in Java

arr[start] = pivot;
arr[end] = temp;

return start;
}
}

You can use the example below to go through the code.

94.2 Version 2: Middle element as pivot

public class QuickSort {


public static void main(String[] args) {
int[] x = { 9, 2, 4, 7, 3, 7, 10 };
[Link]([Link](x));

int low = 0;
int high = [Link] - 1;

quickSort(x, low, high);


[Link]([Link](x));
}

public static void quickSort(int[] arr, int low, int high) {


if (arr == null || [Link] == 0)
return;

if (low >= high)

Program Creek 173 | 568


94 Quicksort Array in Java

return;

// pick the pivot


int middle = low + (high - low) / 2;
int pivot = arr[middle];

// make left < pivot and right > pivot


int i = low, j = high;
while (i <= j) {
while (arr[i] < pivot) {
i++;
}

while (arr[j] > pivot) {


j--;
}

if (i <= j) {
int temp = arr[i];
arr[i] = arr[j];
arr[j] = temp;
i++;
j--;
}
}

// recursively sort two sub parts


if (low < j)
quickSort(arr, low, j);

if (high > i)
quickSort(arr, i, high);
}
}

Output:
9 2 4 7 3 7 10 2 3 4 7 7 9 10
Here is a very good animation of quicksort.

Program Creek 174 | 568


95 Kth Largest Element in an Array
Find the kth largest element in an unsorted array. Note that it is the kth largest element in the sorted order, not
the kth distinct element.
For example, given [3,2,1,5,6,4] and k = 2, return 5.
Note: You may assume k is always valid, 1 ≤ k ≤ array’s length.

95.1 Java Solution 1 - Sorting

public int findKthLargest(int[] nums, int k) {


[Link](nums);
return nums[[Link]-k];
}

Time is O(nlog(n)). The problem of this solution is that sorting all elements is not necessary and is a overkill
for getting just one element.

95.2 Java Solution 2 - Heap


We can use a min heap to solve this problem. The heap stores the top k largest [Link] top of the heap is
the Kth Largest element and all other elements are greater than the heap top. Whenever the size is greater than
k, delete the min. Time complexity is O(nlog(k)). Space complexity is O(k) for storing the top k numbers.

public int findKthLargest(int[] nums, int k) {


PriorityQueue<Integer> q = new PriorityQueue<Integer>(k);
for(int i: nums){
[Link](i);

if([Link]()>k){
[Link]();
}
}

return [Link]();
}

Time complexity of n*log(k) is an improvement to Solution 1. However, this solution requires O(k) space
complexity and it is also maintained k-element heap.

95.3 Java Solution 3 - Quick Sort


This problem can also be solved by using a similar method like quicksort.

public int findKthLargest(int[] nums, int k) {


if (k < 1 || nums == null) {
return 0;
}

175 | 568
95 Kth Largest Element in an Array

return getKth([Link] - k +1, nums, 0, [Link] - 1);


}

public int getKth(int k, int[] nums, int start, int end) {

int pivot = nums[end];

int left = start;


int right = end;

while (true) {

while (nums[left] < pivot && left < right) {


left++;
}

while (nums[right] >= pivot && right > left) {


right--;
}

if (left == right) {
break;
}

swap(nums, left, right);


}

swap(nums, left, end);

if (k == left + 1) {
return pivot;
} else if (k < left + 1) {
return getKth(k, nums, start, left - 1);
} else {
return getKth(k, nums, left + 1, end);
}
}

public void swap(int[] nums, int n1, int n2) {


int tmp = nums[n1];
nums[n1] = nums[n2];
nums[n2] = tmp;
}

Average case time is O(n), worst case time is O(n2̂).

Program Creek 176 | 568


96 Sort Colors
Given an array with n objects colored red, white or blue, sort them so that objects of the same color are adjacent,
with the colors in the order red, white and blue.
Here, we will use the integers 0, 1, and 2 to represent the color red, white, and blue respectively.

96.1 Java Solution - Counting Sort


We can get the count of each element and project them to the original array.

public void sortColors(int[] nums) {


if(nums==null||[Link]<2){
return;
}

int[] countArray = new int[3];


for(int i=0; i<[Link]; i++){
countArray[nums[i]]++;
}

int j = 0;
int k = 0;
while(j<=2){
if(countArray[j]!=0){
nums[k++]=j;
countArray[j] = countArray[j]-1;
}else{
j++;
}
}
}

177 | 568
97 Maximum Gap
Given an unsorted array, find the maximum difference between the successive elements in its sorted form.
Try to solve it in linear time/space. Return 0 if the array contains less than 2 elements. You may assume all
elements in the array are non-negative integers and fit in the 32-bit signed integer range.

97.1 Analysis
We can use a bucket-sort like algorithm to solve this problem in time of O(n) and space O(n). The basic idea
is to project each element of the array to an array of buckets. Each bucket tracks the maximum and minimum
elements. Finally, scanning the bucket list, we can get the maximum gap.
The key part is to get the interval:

From: interval * (num[i] - min) = 0 and interval * (max -num[i]) = n


interval = [Link] / (max - min)

The following diagram shows an example.

97.2 Java Solution

class Bucket{

178 | 568
97 Maximum Gap

int low;
int high;
public Bucket(){
low = -1;
high = -1;
}
}

public int maximumGap(int[] num) {


if(num == null || [Link] < 2){
return 0;
}

int max = num[0];


int min = num[0];
for(int i=1; i<[Link]; i++){
max = [Link](max, num[i]);
min = [Link](min, num[i]);
}

// initialize an array of buckets


Bucket[] buckets = new Bucket[[Link]+1]; //project to (0 - n)
for(int i=0; i<[Link]; i++){
buckets[i] = new Bucket();
}

double interval = (double) [Link] / (max - min);


//distribute every number to a bucket array
for(int i=0; i<[Link]; i++){
int index = (int) ((num[i] - min) * interval);

if(buckets[index].low == -1){
buckets[index].low = num[i];
buckets[index].high = num[i];
}else{
buckets[index].low = [Link](buckets[index].low, num[i]);
buckets[index].high = [Link](buckets[index].high, num[i]);
}
}

//scan buckets to find maximum gap


int result = 0;
int prev = buckets[0].high;
for(int i=1; i<[Link]; i++){
if(buckets[i].low != -1){
result = [Link](result, buckets[i].low-prev);
prev = buckets[i].high;
}

return result;
}

Program Creek 179 | 568


98 Group Anagrams
Given an array of strings, return all groups of strings that are anagrams.
An anagram is a type of word play, the result of rearranging the letters of a word or phrase to produce a new word or
phrase, using all the original letters exactly once; for example, Torchwood can be rearranged into Doctor Who.

98.1 Java Solution


If two strings are anagram to each other, their sorted sequence is the same.

public List<List<String>> groupAnagrams(String[] strs) {


List<List<String>> result = new ArrayList<List<String>>();

HashMap<String, ArrayList<String>> map = new HashMap<String, ArrayList<String>>();


for(String str: strs){
char[] arr = new char[26];
for(int i=0; i<[Link](); i++){
arr[[Link](i)-’a’]++;
}
String ns = new String(arr);

if([Link](ns)){
[Link](ns).add(str);
}else{
ArrayList<String> al = new ArrayList<String>();
[Link](str);
[Link](ns, al);
}
}

[Link]([Link]());

return result;
}

98.2 Time Complexity


If the average length of verbs is m and array length is n, then the time is O(n*m).

180 | 568
99 Ugly Number
Write a program to check whether a given number is an ugly number. Ugly numbers are positive numbers whose
prime factors only include 2, 3, 5. For example, 6, 8 are ugly while 14 is not ugly since it includes another prime
factor 7. Note that 1 is typically treated as an ugly number.

99.1 Java Solution

public boolean isUgly(int num) {


if(num==0) return false;
if(num==1) return true;

if(num%2==0){
num=num/2;
return isUgly(num);
}

if(num%3==0){
num=num/3;
return isUgly(num);
}

if(num%5==0){
num=num/5;
return isUgly(num);
}

return false;
}

181 | 568
100 Ugly Number II
Write a program to find the n-th ugly number. Ugly numbers are positive numbers whose prime factors only
include 2, 3, 5. For example, 1, 2, 3, 4, 5, 6, 8, 9, 10, 12 is the sequence of the first 10 ugly numbers. Note that 1 is
typically treated as an ugly number.

100.1 Java Solution

public int nthUglyNumber(int n) {


if(n<=0)
return 0;

ArrayList<Integer> list = new ArrayList<Integer>();


[Link](1);

int i=0;
int j=0;
int k=0;

while([Link]()<n){
int m2 = [Link](i)*2;
int m3 = [Link](j)*3;
int m5 = [Link](k)*5;

int min = [Link](m2, [Link](m3, m5));


[Link](min);

if(min==m2)
i++;

if(min==m3)
j++;

if(min==m5)
k++;
}

return [Link]([Link]()-1);
}

182 | 568
101 Super Ugly Number
Write a program to find the nth super ugly number.
Super ugly numbers are positive numbers whose all prime factors are in the given prime list primes of size k.
For example, [1, 2, 4, 7, 8, 13, 14, 16, 19, 26, 28, 32] is the sequence of the first 12 super ugly numbers given primes
= [2, 7, 13, 19] of size 4.
Note: (1) 1 is a super ugly number for any given primes. (2) The given numbers in primes are in ascending
order. (3) 0 <k <= 100, 0 <n <= 106, 0 <primes[i] <1000.

101.1 Java Solution


Keep adding minimum values to results and updating the time value for the chosen prime number in each loop.

public int nthSuperUglyNumber(int n, int[] primes) {


int[] times = new int[[Link]];
int[] result = new int[n];
result[0] = 1; // first is 1

for (int i = 1; i < n; i++) {


int min = Integer.MAX_VALUE;
for (int j = 0; j < [Link]; j++) {
min = [Link](min, primes[j] * result[times[j]]);
}

result[i] = min;

for (int j = 0; j < [Link]; j++) {


if (result[times[j]] * primes[j] == min) {
times[j]++;
}
}
}

return result[n - 1];


}

183 | 568
102 Find K Pairs with Smallest Sums
You are given two integer arrays nums1 and nums2 sorted in ascending order and an integer k.
Define a pair (u,v) which consists of one element from the first array and one element from the second array.
Find the k pairs (u1,v1),(u2,v2) ...(uk,vk) with the smallest sums.
Example:

Given nums1 = [1,7,11], nums2 = [2,4,6], k = 3

Return: [1,2],[1,4],[1,6]

The first 3 pairs are returned from the sequence:


[1,2],[1,4],[1,6],[7,2],[7,4],[11,2],[7,6],[11,4],[11,6]

102.1 Java Solution


This problem is similar to Super Ugly Number. The basic idea is using an array to track the index of the next
element in the other array.
The best way to understand this solution is using an example such as nums1=1,3,11 and nums2=2,4,8.

public List<int[]> kSmallestPairs(int[] nums1, int[] nums2, int k) {


int total=[Link]*[Link];
if(total<k){
k=total;
}

List<int[]> result = new ArrayList<int[]>();


int[] idx = new int[[Link]];//track each element’s cursor in nums2
while(k>0){
int min=Integer.MAX_VALUE;
int minIdx=-1;
for(int i=0; i<[Link]; i++){
if(idx[i]<[Link] && nums1[i]+nums2[idx[i]]<min){
minIdx=i;
min=nums1[i]+nums2[idx[i]];
}
}
[Link](new int[]{nums1[minIdx],nums2[idx[minIdx]]});
idx[minIdx]++;
k--;
}

return result;
}

184 | 568
103 Rotate Array in Java
Rotate an array of n elements to the right by k steps.
For example, with n = 7 and k = 3, the array [1,2,3,4,5,6,7] is rotated to [5,6,7,1,2,3,4]. How many different ways
do you know to solve this problem?

103.1 Solution 1 - Intermediate Array


In a straightforward way, we can create a new array and then copy elements to the new array. Then change the
original array by using [Link]().

public void rotate(int[] nums, int k) {


if(k > [Link])
k=k%[Link];

int[] result = new int[[Link]];

for(int i=0; i < k; i++){


result[i] = nums[[Link]-k+i];
}

int j=0;
for(int i=k; i<[Link]; i++){
result[i] = nums[j];
j++;
}

[Link]( result, 0, nums, 0, [Link] );


}

Space is O(n) and time is O(n). You can check out the difference between [Link]() and [Link]().

103.2 Solution 2 - Bubble Rotate


Can we do this in O(1) space?
This solution is like a bubble sort.

public static void rotate(int[] arr, int order) {


if (arr == null || order < 0) {
throw new IllegalArgumentException("Illegal argument!");
}

for (int i = 0; i < order; i++) {


for (int j = [Link] - 1; j > 0; j--) {
int temp = arr[j];
arr[j] = arr[j - 1];
arr[j - 1] = temp;
}
}
}

185 | 568
103 Rotate Array in Java

However, the time is O(n*k).


Here is an example (length=7, order=3):

i=0
0 1 2 3 4 5 6
0 1 2 3 4 6 5
...
6 0 1 2 3 4 5
i=1
6 0 1 2 3 5 4
...
5 6 0 1 2 3 4
i=2
5 6 0 1 2 4 3
...
4 5 6 0 1 2 3

103.3 Solution 3 - Reversal


Can we do this in O(1) space and in O(n) time? The following solution does.
Assuming we are given 1,2,3,4,5,6 and order 2. The basic idea is:

1. Divide the array two parts: 1,2,3,4 and 5, 6


2. Reverse first part: 4,3,2,1,5,6
3. Reverse second part: 4,3,2,1,6,5
4. Reverse the whole array: 5,6,1,2,3,4

public static void rotate(int[] arr, int order) {


if (arr == null || [Link]==0 || order < 0) {
throw new IllegalArgumentException("Illegal argument!");
}

if(order > [Link]){


order = order %[Link];
}

//length of first part


int a = [Link] - order;

reverse(arr, 0, a-1);
reverse(arr, a, [Link]-1);
reverse(arr, 0, [Link]-1);

public static void reverse(int[] arr, int left, int right){


if(arr == null || [Link] == 1)
return;

while(left < right){


int temp = arr[left];
arr[left] = arr[right];
arr[right] = temp;
left++;
right--;

Program Creek 186 | 568


103 Rotate Array in Java

}
}

Program Creek 187 | 568


104 Reverse Words in a String II
Given an input string, reverse the string word by word. A word is defined as a sequence of non-space characters.
The input string does not contain leading or trailing spaces and the words are always separated by a single
space.
For example, Given s = "the sky is blue", return "blue is sky the".
Could you do it in-place without allocating extra space?

104.1 Java Solution

public void reverseWords(char[] s) {


int i=0;
for(int j=0; j<[Link]; j++){
if(s[j]==’ ’){
reverse(s, i, j-1);
i=j+1;
}
}

reverse(s, i, [Link]-1);

reverse(s, 0, [Link]-1);
}

public void reverse(char[] s, int i, int j){


while(i<j){
char temp = s[i];
s[i]=s[j];
s[j]=temp;
i++;
j--;
}
}

188 | 568
105 Missing Number
Given an array containing n distinct numbers taken from 0, 1, 2, ..., n, find the one that is missing from the array.
For example, given nums = [0, 1, 3] return 2.

105.1 Java Solution 1 - Math

public int missingNumber(int[] nums) {


int sum=0;
for(int i=0; i<[Link]; i++){
sum+=nums[i];
}

int n=[Link];
return n*(n+1)/2-sum;
}

105.2 Java Solution 2 - Bit

public int missingNumber(int[] nums) {

int miss=0;
for(int i=0; i<[Link]; i++){
miss ^= (i+1) ^nums[i];
}

return miss;
}

105.3 Java Solution 3 - Binary Search

public int missingNumber(int[] nums) {


[Link](nums);
int l=0, r=[Link];
while(l<r){
int m = (l+r)/2;
if(nums[m]>m){
r=m;
}else{
l=m+1;
}
}

return r;
}

189 | 568
106 Find the Duplicate Number
Given an array containing n + 1 integers where each integer is between 1 and n (inclusive), prove that at least one
duplicate number must exist. Assume that there is only one duplicate number, find the duplicate one.
Note: 1) You must not modify the array (assume the array is read only). 2) You must use only constant, O(1)
extra space. 3) Your runtime complexity should be less than O(n2̂). 4) There is only one duplicate number in the
array, but it could be repeated more than once.

106.1 Java Solution - Finding Cycle


The following shows how fast and slow pointers solution works. It basically contains 2 steps: 1) find the meeting
point 2) start from the beginning and the meeting point respectively and find the intersection point.

public int findDuplicate(int[] nums) {


int slow = 0;
int fast = 0;

do{
slow = nums[slow];
fast = nums[nums[fast]];
} while(slow != fast);

int find = 0;

while(find != slow){
slow = nums[slow];
find = nums[find];
}
return find;
}

If we can assume there is only one duplicate number, it can be easily solved by using the sum of the array.

190 | 568
106 Find the Duplicate Number

public int findDuplicate(int[] nums) {


int sum = 0;
for(int i: nums){
sum+=i;
}

int n=[Link];
return sum - ((n-1)*n)/2;
}

Program Creek 191 | 568


107 First Missing Positive
Given an unsorted integer array, find the first missing positive integer. For example, given [1,2,0] return 3 and
[3,4,-1,1] return 2.
Your algorithm should run in O(n) time and uses constant space.

107.1 Analysis
This problem can solve by using a bucket-sort like algorithm. Let’s consider finding first missing positive and 0
first. The key fact is that the ith element should be i, so we have: i==A[i] A[i]==A[A[i]]
For example, given an array 1,2,0,4, the algorithm does the following:

int firstMissingPositiveAnd0(int A[]) {


int n = [Link];
for (int i = 0; i < n; i++) {
// when the ith element is not i
while (A[i] != i) {
// no need to swap when ith element is out of range [0,n]
if (A[i] < 0 || A[i] >= n)
break;

//handle duplicate elements


if(A[i]==A[A[i]])
break;
// swap elements
int temp = A[i];
A[i] = A[temp];
A[temp] = temp;
}
}

192 | 568
107 First Missing Positive

for (int i = 0; i < n; i++) {


if (A[i] != i)
return i;
}

return n;
}

107.2 Java Solution


This problem only considers positive numbers, so we need to shift 1 offset. The ith element is i+1.

public int firstMissingPositive(int[] A) {


int n = [Link];

for (int i = 0; i < n; i++) {


while (A[i] != i + 1) {
if (A[i] <= 0 || A[i] >= n)
break;

if(A[i]==A[A[i]-1])
break;

int temp = A[i];


A[i] = A[temp - 1];
A[temp - 1] = temp;
}
}

for (int i = 0; i < n; i++){


if (A[i] != i + 1){
return i + 1;
}
}

return n + 1;
}

Program Creek 193 | 568


108 Queue Reconstruction by Height
Suppose you have a random list of people standing in a queue. Each person is described by a pair of integers (h,
k), where h is the height of the person and k is the number of people in front of this person who have a height
greater than or equal to h. Write an algorithm to reconstruct the queue.
Note: The number of people is less than 1,100.
Example
Input: [[7,0], [4,4], [7,1], [5,0], [6,1], [5,2]]
Output: [[5,0], [7,0], [5,2], [6,1], [4,4], [7,1]]

108.1 Analysis
The key to solve this problem is finding the start point of reconstruction. For this problem, we can start adding
the largest element first. The basic idea is to keep adding the largest element each time, until all elements are in
place.

108.2 Java Solution

public int[][] reconstructQueue(int[][] people) {


int[][] result = new int[[Link]][];
[Link](people, new Comparator<int[]>(){
public int compare(int[] a1, int[] a2){
if(a1[0]!=a2[0]){
return a2[0]-a1[0];
}else{
return a1[1]-a2[1];
}
}
});

ArrayList<int[]> list = new ArrayList<int[]>();

for(int i=0; i<[Link]; i++){


int[] arr = people[i];
[Link](arr[1],arr);
}

for(int i=0; i<[Link]; i++){


result[i]=[Link](i);
}

return result;
}

Time complexity of this solution is O(n2̂).

194 | 568
109 Binary Watch
Given a non-negative integer n which represents the number of LEDs that are currently on, return all possible
times the watch could represent.
Example:
Input: n = 1 Return: ["1:00", "2:00", "4:00", "8:00", "0:01", "0:02", "0:04", "0:08", "0:16", "0:32"]

109.1 Accepted Java Solution

public List<String> readBinaryWatch(int num) {


List<String> result = new ArrayList<String>();

for(int i=0; i<12; i++){


for(int j=0; j<60; j++){
int total = countDigits(i)+countDigits(j);
if(total==num){
String s="";
s+=i+":";

if(j<10){
s+="0"+j;
}else{
s+=j;
}

[Link](s);
}
}
}

return result;
}

public int countDigits(int num){


int result=0;

while(num>0){
if((num&1)==1){
result++;
}

num>>=1;
}

return result;
}

Time complexity is constant (12*60).

195 | 568
109 Binary Watch

109.2 Naive Solution

public class Solution {


public List<String> readBinaryWatch(int num) {

List<String> result = new ArrayList<String>();

for(int i=0; i<=4; i++){


int h=i;
int m=num-i;

ArrayList<ArrayList<Integer>> hSet = new ArrayList<ArrayList<Integer>>();


subSet(h, 4, 1, new ArrayList<Integer>(), hSet);

ArrayList<ArrayList<Integer>> mSet = new ArrayList<ArrayList<Integer>>();


subSet(m, 6, 1, new ArrayList<Integer>(), mSet);

ArrayList<String> hoursList = new ArrayList<String>();


ArrayList<String> minsList = new ArrayList<String>();

if([Link]()==0){
[Link]("0");
}else{
[Link](getTime(hSet, true));
}

if([Link]()==0){
[Link]("00");
}else{
[Link](getTime(mSet, false));
}

for(int x=0; x<[Link](); x++){


for(int y=0; y<[Link](); y++){
[Link]([Link](x)+":"+[Link](y));
}
}

return result;
}

public ArrayList<String> getTime(ArrayList<ArrayList<Integer>> lists, boolean isHour){


ArrayList<String> result = new ArrayList<String>();

for(ArrayList<Integer> l : lists){
int sum=0;
for(int i: l){
sum+= (1<<(i-1));
}
if(isHour && sum>=12)
continue;

if(!isHour&&sum>=60)

Program Creek 196 | 568


109 Binary Watch

continue;

if(sum<10 && !isHour){


[Link]("0"+sum);
}else{
[Link](""+sum);
}
}

return result;
}

public void subSet(int k, int m, int start, ArrayList<Integer> temp, ArrayList<ArrayList<Integer>>


result){
if(k==0){
[Link](new ArrayList<Integer>(temp));
return;
}

for(int i=start; i<=m; i++){


[Link](i);
subSet(k-1, m, i+1, temp, result);
[Link]([Link]()-1);
}
}
}

Program Creek 197 | 568


110 Search a 2D Matrix
Write an efficient algorithm that searches for a value in an m x n matrix. This matrix has properties:
1) Integers in each row are sorted from left to right. 2) The first integer of each row is greater than the last
integer of the previous row.
For example, consider the following matrix:

[
[1, 3, 5, 7],
[10, 11, 16, 20],
[23, 30, 34, 50]
]

Given target = 3, return true.

110.1 Java Solution


This is a typical problem of binary search.
You may try to solve this problem by finding the row first and then the column. There is no need to do that.
Because of the matrix’s special features, the matrix can be considered as a sorted array. The goal is to find the
element in this sorted array by using binary search.

public class Solution {


public boolean searchMatrix(int[][] matrix, int target) {
if(matrix==null || [Link]==0 || matrix[0].length==0)
return false;

int m = [Link];
int n = matrix[0].length;

int start = 0;
int end = m*n-1;

while(start<=end){
int mid=(start+end)/2;
int midX=mid/n;
int midY=mid%n;

if(matrix[midX][midY]==target)
return true;

if(matrix[midX][midY]<target){
start=mid+1;
}else{
end=mid-1;
}
}

return false;
}
}

198 | 568
111 Search a 2D Matrix II
Write an efficient algorithm that searches for a value in an m x n matrix. This matrix has the following properties:
Integers in each row are sorted in ascending from left to right. Integers in each column are sorted in ascending
from top to bottom.
For example, consider the following matrix:

[
[1, 4, 7, 11, 15],
[2, 5, 8, 12, 19],
[3, 6, 9, 16, 22],
[10, 13, 14, 17, 24],
[18, 21, 23, 26, 30]
]

Given target = 5, return true.

111.1 Java Solution 1


In a naive approach, we can use the matrix boundary to reduce the search space. Here is a simple recursive
implementation.

public boolean searchMatrix(int[][] matrix, int target) {


int i1=0;
int i2=[Link]-1;
int j1=0;
int j2=matrix[0].length-1;

return helper(matrix, i1, i2, j1, j2, target);


}

public boolean helper(int[][] matrix, int i1, int i2, int j1, int j2, int target){

if(i1>i2||j1>j2)
return false;

for(int j=j1;j<=j2;j++){
if(target < matrix[i1][j]){
return helper(matrix, i1, i2, j1, j-1, target);
}else if(target == matrix[i1][j]){
return true;
}
}

for(int i=i1;i<=i2;i++){
if(target < matrix[i][j1]){
return helper(matrix, i1, i-1, j1, j2, target);
}else if(target == matrix[i][j1]){
return true;
}
}

199 | 568
111 Search a 2D Matrix II

for(int j=j1;j<=j2;j++){
if(target > matrix[i2][j]){
return helper(matrix, i1, i2, j+1, j2, target);
}else if(target == matrix[i2][j]){
return true;
}
}

for(int i=i1;i<=i2;i++){
if(target > matrix[i][j2]){
return helper(matrix, i1, i+1, j1, j2, target);
}else if(target == matrix[i][j2]){
return true;
}
}

return false;
}

111.2 Java Solution 2


Time Complexity: O(m + n)

public boolean searchMatrix(int[][] matrix, int target) {


int m=[Link]-1;
int n=matrix[0].length-1;

int i=m;
int j=0;

while(i>=0 && j<=n){


if(target < matrix[i][j]){
i--;
}else if(target > matrix[i][j]){
j++;
}else{
return true;
}
}

return false;
}

Program Creek 200 | 568


112 Kth Smallest Element in a Sorted Matrix
Given a n x n matrix where each of the rows and columns are sorted in ascending order, find the kth smallest
element in the matrix.
Note that it is the kth smallest element in the sorted order, not the kth distinct element.
Example:

matrix = [
[ 1, 5, 9],
[10, 11, 13],
[12, 13, 15]
],

k = 8,
return 13.

112.1 Java Solution


This problem is similar to Search a 2D Matrix II. The start point of such a sorted matrix is left-bottom corner.

public int kthSmallest(int[][] matrix, int k) {


int m=[Link];

int lower = matrix[0][0];


int upper = matrix[m-1][m-1];

while(lower<upper){
int mid = lower + ((upper-lower)>>1);
int count = count(matrix, mid);
if(count<k){
lower=mid+1;
}else{
upper=mid;
}
}

return upper;
}

private int count(int[][] matrix, int target){


int m=[Link];
int i=m-1;
int j=0;
int count = 0;

while(i>=0&&j<m){
if(matrix[i][j]<=target){
count += i+1;
j++;
}else{
i--;

201 | 568
112 Kth Smallest Element in a Sorted Matrix

}
}

return count;
}

Program Creek 202 | 568


113 Design Snake Game
Design a Snake game that is played on a device with screen size = width x height. Play the game online if you
are not familiar with the game.
The snake is initially positioned at the top left corner (0,0) with length = 1 unit.
You are given a list of food’s positions in row-column order. When a snake eats the food, its length and the
game’s score both increase by 1.
Each food appears one by one on the screen. For example, the second food will not appear until the first food
was eaten by the snake.
When a food does appear on the screen, it is guaranteed that it will not appear on a block occupied by the
snake.

113.1 Java Solution


We can use a queue to track the snake positions.

public class SnakeGame {


int[][] food;
int index;
int row, col;
int x, y;
int len;
LinkedList<int[]> queue;
/** Initialize your data structure here.
@param width - screen width
@param height - screen height
@param food - A list of food positions
E.g food = [[1,1], [1,0]] means the first food is positioned at [1,1], the second is at [1,0]. */
public SnakeGame(int width, int height, int[][] food) {
[Link]=food;
[Link]=0;
this.x=0;
this.y=0;
[Link]=height;
[Link]=width;
[Link]= new LinkedList<int[]>();
[Link](new int[]{0, 0});
}

/** Moves the snake.


@param direction - ’U’ = Up, ’L’ = Left, ’R’ = Right, ’D’ = Down
@return The game’s score after the move. Return -1 if game over.
Game over when snake crosses the screen boundary or bites its body. */
public int move(String direction) {
switch(direction){
case "U":
x--;
break;
case "L":
y--;
break;

203 | 568
113 Design Snake Game

case "R":
y++;
break;
case "D":
x++;
break;
}

if(!isValid(x,y)){
return -1;
}

return process(x, y);


}

public boolean isValid(int x, int y){


if(x<0 || x>=row || y<0 || y>=col)
return false;

return true;
}

public int process(int x, int y){

if(index==[Link]){
[Link]();

}else if(food[index][0]==x && food[index][1]==y){


len++;
index++;
}else{
[Link]();
}

for(int[] p: queue){
if(p[0]==x&&p[1]==y)
return -1;
}

[Link](new int[]{x,y});

return len;
}
}

Program Creek 204 | 568


114 Number of Islands II
A 2d grid map of m rows and n columns is initially filled with water. We may perform an addLand operation
which turns the water at position (row, col) into a land. Given a list of positions to operate, count the number of
islands after each addLand operation. An island is surrounded by water and is formed by connecting adjacent
lands horizontally or vertically. You may assume all four edges of the grid are all surrounded by water.

114.1 Java Solution


Use an array to track the parent node for each cell.

public List<Integer> numIslands2(int m, int n, int[][] positions) {


int[] rootArray = new int[m*n];
[Link](rootArray,-1);

ArrayList<Integer> result = new ArrayList<Integer>();

int[][] directions = {{-1,0},{0,1},{1,0},{0,-1}};


int count=0;

for(int k=0; k<[Link]; k++){


count++;

int[] p = positions[k];
int index = p[0]*n+p[1];
rootArray[index]=index;//set root to be itself for each node

for(int r=0;r<4;r++){
int i=p[0]+directions[r][0];
int j=p[1]+directions[r][1];

if(i>=0&&j>=0&&i<m&&j<n&&rootArray[i*n+j]!=-1){
//get neighbor’s root
int thisRoot = getRoot(rootArray, i*n+j);
if(thisRoot!=index){
rootArray[thisRoot]=index;//set previous root’s root
count--;
}
}
}

[Link](count);
}

return result;
}

public int getRoot(int[] arr, int i){


while(i!=arr[i]){
i=arr[i];
}

205 | 568
114 Number of Islands II

return i;
}

Program Creek 206 | 568


115 Number of Connected Components in an
Undirected Graph
Given n nodes labeled from 0 to n - 1 and a list of undirected edges (each edge is a pair of nodes), write a function
to find the number of connected components in an undirected graph.
For example:

0 3
| |
1 --- 2 4

Given n = 5 and edges = [[0, 1], [1, 2], [3, 4]], return 2.

115.1 Java Solution - Union-find


This problem can be solved by using union-find beautifully. Initially, there are n nodes. The nodes that are
involved in each edge is merged.

207 | 568
115 Number of Connected Components in an Undirected Graph

public int countComponents(int n, int[][] edges) {


int count = n;

int[] root = new int[n];


// initialize each node is an island
for(int i=0; i<n; i++){
root[i]=i;
}

for(int i=0; i<[Link]; i++){


int x = edges[i][0];
int y = edges[i][1];

int xRoot = getRoot(root, x);


int yRoot = getRoot(root, y);

if(xRoot!=yRoot){
count--;
root[xRoot]=yRoot;
}

Program Creek 208 | 568


115 Number of Connected Components in an Undirected Graph

return count;
}

public int getRoot(int[] arr, int i){


while(arr[i]!=i){
arr[i]= arr[arr[i]];
i=arr[i];
}
return i;
}

There are k loops and each loop processing the root array costs log(n). Therefore, time complexity is O(k*log(n)).

Program Creek 209 | 568


116 Most Stones Removed with Same Row or
Column
The easiest solution for this problem is the union-find. The number of island problem can help understand how
union-find works.
The basic idea is that we use a disjoint set to track each component. Whenever two stones can be connected,
the number of islands decrease one. The final result, the number of movement, is the total number of stones - the
number of islands.
Example 1:

Input: stones = [[0,0],[0,1],[1,0],[1,2],[2,1],[2,2]]


Output: 5

Note:

1 <= [Link] <= 1000


0 <= stones[i][j] < 10000

116.1 Java Solution 1 - Regular Disjoint Set

class Solution {
int[] root = new int[1000]; //value is index
int result = 0;

public int removeStones(int[][] stones) {


result = [Link];
for(int i=0; i<[Link]; i++){
root[i]=i;
}

for(int i=0; i<[Link]; i++){


for(int j=i+1; j<[Link]; j++){
if(stones[i][0]==stones[j][0] || stones[i][1]==stones[j][1]){
union(i, j);
}
}
}

return [Link]-result;
}

public void union(int i, int j){


int ri = getRoot(i);
int rj = getRoot(j);

if(ri==rj){
return;
}

210 | 568
116 Most Stones Removed with Same Row or Column

root[getRoot(i)]=getRoot(j);
result--;
}

public int getRoot(int i){


while(i!=root[i]){
i=root[i];
}

return i;
}
}

Time complexity is O(N2̂ * log(N)).

116.2 Java Solution 2 - Optimized Disjoint Set

class Solution {
public int removeStones(int[][] stones) {
DisjointSet ds = new DisjointSet(20000);
for(int[] stone: stones){
[Link](stone[0], stone[1]+10000);
}

HashSet<Integer> set = new HashSet<>();


for(int[] stone: stones){
[Link]([Link](stone[0]));
}

return [Link] - [Link]();


}
}

class DisjointSet{
int[] parent;
public DisjointSet(int size){
parent = new int[size];
for(int i=0; i<size; i++){
parent[i] = i;
}
}

public void union(int i, int j){


parent[find(i)] = find(j);
}

public int find(int i){


while(parent[i] != i){
i = parent[i];
}

return i;
}
}

Program Creek 211 | 568


116 Most Stones Removed with Same Row or Column

Time complexity is log(20000)*N = O(N)

Program Creek 212 | 568


117 Longest Increasing Path in a Matrix
Given an integer matrix, find the length of the longest increasing path.
From each cell, you can either move to four directions: left, right, up or down. You may NOT move diagonally
or move outside of the boundary
Example 1:

Input: nums =
[
[9,9,4],
[6,6,8],
[2,1,1]
]
Output: 4
Explanation: The longest increasing path is [1, 2, 6, 9].

117.1 Java Solution 1 - Naive DFS

public int longestIncreasingPath(int[][] matrix) {


if(matrix==null||[Link]==0||matrix[0].length==0)
return 0;

int[] max = new int[1];


for(int i=0; i<[Link]; i++) {
for(int j=0; j<matrix[0].length; j++){
dfs(matrix, i, j, max, 1);
}
}

return max[0];
}

public void dfs(int[][] matrix, int i, int j, int[] max, int len){

max[0]=[Link](max[0], len);

int m=[Link];
int n=matrix[0].length;

int[] dx={-1, 0, 1, 0};


int[] dy={0, 1, 0, -1};

for(int k=0; k<4; k++){


int x = i+dx[k];
int y = j+dy[k];

if(x>=0 && x<m && y>=0 && y<n && matrix[x][y]>matrix[i][j]){


dfs(matrix, x, y, max, len+1);
}

213 | 568
117 Longest Increasing Path in a Matrix

}
}

This naive DFS solution’s time complexity is O(m*n*4ˆ(m+n)).

117.2 Java Solution 2- Optimization with memorization


A common approach to improve DFS is through memorization.

public int longestIncreasingPath(int[][] matrix) {


if (matrix == null || [Link] == 0 || matrix[0].length == 0) {
return 0;
}

int result = 0;
int m = [Link];
int n = matrix[0].length;

int[][] mem = new int[m][n];


for (int i = 0; i < m; i++) {
for (int j = 0; j < n; j++) {
int t = helper(matrix, mem, i, j);
result = [Link](result, t);
}
}

return result;
}

private int helper(int[][] matrix, int[][] mem, int i, int j) {


if (mem[i][j] > 0) {
return mem[i][j];
}

int[] dx = {-1, 0, 1, 0};


int[] dy = {0, 1, 0, -1};

for (int k = 0; k < 4; k++) {


int x = i + dx[k];
int y = j + dy[k];

if (x >= 0 && y >= 0


&& x < [Link]
&& y < matrix[0].length
&& matrix[x][y] > matrix[i][j]) {
mem[i][j] = [Link](mem[i][j], helper(matrix, mem, x, y));
}
}

return ++mem[i][j];
}

Because of the memorization matrix, the upper bound time complexity of the DFS is O(m*n). With the loop in
the main method, the overall time complexity is O(m2̂ * n2̂)

Program Creek 214 | 568


117 Longest Increasing Path in a Matrix

Program Creek 215 | 568


118 Word Search
Given a 2D board and a word, find if the word exists in the grid.
The word can be constructed from letters of sequentially adjacent cell, where "adjacent" cells are those horizon-
tally or vertically neighboring. The same letter cell may not be used more than once.
For example, given board =

[
["ABCE"],
["SFCS"],
["ADEE"]
]

word = "ABCCED", ->returns true, word = "SEE", ->returns true, word = "ABCB", ->returns false.

118.1 Java Solution


This problem can be solve by using a typical DFS algorithm.

public boolean exist(char[][] board, String word) {


int m = [Link];
int n = board[0].length;

boolean result = false;


for(int i=0; i<m; i++){
for(int j=0; j<n; j++){
if(dfs(board,word,i,j,0)){
result = true;
}
}
}

return result;
}

public boolean dfs(char[][] board, String word, int i, int j, int k){
int m = [Link];
int n = board[0].length;

if(i<0 || j<0 || i>=m || j>=n){


return false;
}

if(board[i][j] == [Link](k)){
char temp = board[i][j];
board[i][j]=’#’;
if(k==[Link]()-1){
return true;
}else if(dfs(board, word, i-1, j, k+1)
||dfs(board, word, i+1, j, k+1)
||dfs(board, word, i, j-1, k+1)

216 | 568
118 Word Search

||dfs(board, word, i, j+1, k+1)){


return true;
}
board[i][j]=temp;
}

return false;
}

Similarly, below is another way of writing this algorithm.

public boolean exist(char[][] board, String word) {


for(int i=0; i<[Link]; i++){
for(int j=0; j<board[0].length; j++){
if(dfs(board, word, i, j, 0)){
return true;
}
}
}

return false;
}

public boolean dfs(char[][] board, String word, int i, int j, int k){
if(board[i][j]!=[Link](k)){
return false;
}

Program Creek 217 | 568


118 Word Search

if(k>=[Link]()-1){
return true;
}

int[] di={-1,0,1,0};
int[] dj={0,1,0,-1};

char t = board[i][j];
board[i][j]=’#’;

for(int m=0; m<4; m++){


int pi=i+di[m];
int pj=j+dj[m];
if(pi>=0&&pi<[Link]&&pj>=0&&pj<board[0].length&&board[pi][pj]==[Link](k+1)){
if(dfs(board,word,pi,pj,k+1)){
return true;
}
}
}

board[i][j]=t;

return false;
}

Program Creek 218 | 568


119 Word Search II
Given a 2D board and a list of words from the dictionary, find all words in the board.
Each word must be constructed from letters of sequentially adjacent cell, where "adjacent" cells are those
horizontally or vertically neighboring. The same letter cell may not be used more than once in a word.
For example, given words = ["oath","pea","eat","rain"] and board =

[
[’o’,’a’,’a’,’n’],
[’e’,’t’,’a’,’e’],
[’i’,’h’,’k’,’r’],
[’i’,’f’,’l’,’v’]
]

Return ["eat","oath"].

119.1 Java Solution 1


Similar to Word Search, this problem can be solved by DFS. However, this solution exceeds time limit.

public List<String> findWords(char[][] board, String[] words) {


ArrayList<String> result = new ArrayList<String>();

int m = [Link];
int n = board[0].length;

for (String word : words) {


boolean flag = false;
for (int i = 0; i < m; i++) {
for (int j = 0; j < n; j++) {
char[][] newBoard = new char[m][n];
for (int x = 0; x < m; x++)
for (int y = 0; y < n; y++)
newBoard[x][y] = board[x][y];

if (dfs(newBoard, word, i, j, 0)) {


flag = true;
}
}
}
if (flag) {
[Link](word);
}
}

return result;
}

public boolean dfs(char[][] board, String word, int i, int j, int k) {


int m = [Link];
int n = board[0].length;

219 | 568
119 Word Search II

if (i < 0 || j < 0 || i >= m || j >= n || k > [Link]() - 1) {


return false;
}

if (board[i][j] == [Link](k)) {
char temp = board[i][j];
board[i][j] = ’#’;

if (k == [Link]() - 1) {
return true;
} else if (dfs(board, word, i - 1, j, k + 1)
|| dfs(board, word, i + 1, j, k + 1)
|| dfs(board, word, i, j - 1, k + 1)
|| dfs(board, word, i, j + 1, k + 1)) {
board[i][j] = temp;
return true;
}

} else {
return false;
}

return false;
}

119.2 Java Solution 2 - Trie


If the current candidate does not exist in all words’ prefix, we can stop backtracking immediately. This can be
done by using a trie structure.

public class Solution {


Set<String> result = new HashSet<String>();

public List<String> findWords(char[][] board, String[] words) {


//HashSet<String> result = new HashSet<String>();

Trie trie = new Trie();


for(String word: words){
[Link](word);
}

int m=[Link];
int n=board[0].length;

boolean[][] visited = new boolean[m][n];

for(int i=0; i<m; i++){


for(int j=0; j<n; j++){
dfs(board, visited, "", i, j, trie);
}
}

return new ArrayList<String>(result);


}

Program Creek 220 | 568


119 Word Search II

public void dfs(char[][] board, boolean[][] visited, String str, int i, int j, Trie trie){
int m=[Link];
int n=board[0].length;

if(i<0 || j<0||i>=m||j>=n){
return;
}

if(visited[i][j])
return;

str = str + board[i][j];

if(![Link](str))
return;

if([Link](str)){
[Link](str);
}

visited[i][j]=true;
dfs(board, visited, str, i-1, j, trie);
dfs(board, visited, str, i+1, j, trie);
dfs(board, visited, str, i, j-1, trie);
dfs(board, visited, str, i, j+1, trie);
visited[i][j]=false;
}
}

//Trie Node
class TrieNode{
public TrieNode[] children = new TrieNode[26];
public String item = "";
}

//Trie
class Trie{
public TrieNode root = new TrieNode();

public void insert(String word){


TrieNode node = root;
for(char c: [Link]()){
if([Link][c-’a’]==null){
[Link][c-’a’]= new TrieNode();
}
node = [Link][c-’a’];
}
[Link] = word;
}

public boolean search(String word){


TrieNode node = root;
for(char c: [Link]()){
if([Link][c-’a’]==null)
return false;
node = [Link][c-’a’];
}

Program Creek 221 | 568


119 Word Search II

if([Link](word)){
return true;
}else{
return false;
}
}

public boolean startsWith(String prefix){


TrieNode node = root;
for(char c: [Link]()){
if([Link][c-’a’]==null)
return false;
node = [Link][c-’a’];
}
return true;
}
}

Program Creek 222 | 568


120 Number of Islands
Given a 2-d grid map of ’1’s (land) and ’0’s (water), count the number of islands. An island is surrounded by
water and is formed by connecting adjacent lands horizontally or vertically. You may assume all four edges of
the grid are all surrounded by water.
Example 1:

11110
11010
11000
00000

Answer: 1

120.1 Java Solution 1 - DFS


The basic idea of the following solution is merging adjacent lands, and the merging should be done recursively.
Each element is visited once only. So time is O(m*n).

public int numIslands(char[][] grid) {


if(grid==null || [Link]==0||grid[0].length==0)
return 0;

int m = [Link];
int n = grid[0].length;

int count=0;
for(int i=0; i<m; i++){
for(int j=0; j<n; j++){
if(grid[i][j]==’1’){
count++;
merge(grid, i, j);
}
}
}

return count;
}

public void merge(char[][] grid, int i, int j){


int m=[Link];
int n=grid[0].length;

if(i<0||i>=m||j<0||j>=n||grid[i][j]!=’1’)
return;

grid[i][j]=’X’;

merge(grid, i-1, j);


merge(grid, i+1, j);
merge(grid, i, j-1);

223 | 568
120 Number of Islands

merge(grid, i, j+1);
}

120.2 Java Solution 2 - Union-Find


Time is O(m*n*log(k)).

public int numIslands(char[][] grid) {


if(grid==null || [Link]==0 || grid[0].length==0)
return 0;

int m = [Link];
int n = grid[0].length;

int[] dx={-1, 1, 0, 0};


int[] dy={0, 0, -1, 1};

int[] root = new int[m*n];

int count=0;
for(int i=0; i<m; i++){
for(int j=0; j<n; j++){
if(grid[i][j]==’1’){
root[i*n+j] = i*n+j;
count++;
}
}
}

for(int i=0; i<m; i++){


for(int j=0; j<n; j++){
if(grid[i][j]==’1’){
for(int k=0; k<4; k++){
int x = i+dx[k];
int y = j+dy[k];

if(x>=0&&x<m&&y>=0&&y<n&&grid[x][y]==’1’){
int cRoot = getRoot(root, i*n+j);
int nRoot = getRoot(root, x*n+y);
if(nRoot!=cRoot){
root[cRoot]=nRoot; //update previous node’s root to be current
count--;
}

}
}
}
}
}

return count;
}

public int getRoot(int[] arr , int i){


while(arr[i]!=i){
i = arr[arr[i]];

Program Creek 224 | 568


120 Number of Islands

return i;
}

Check out Number of Island II.

Program Creek 225 | 568


121 Find a Path in a Matrix
Given a 2d matrix, find a path from the top left corner to bottom right corner. Assume there exists at least one
path, and you only need to find one valid path. You can move up, right, down, left at any position.
For example, given

[1, 0, 0, 0, 0]
[1, 0, 1, 1, 1]
[1, 1, 1, 0, 1]
[1, 0, 0, 0, 1]
[1, 0, 0, 0, 1]

A valid path is

[1, 0, 0, 0, 0]
[1, 0, 1, 1, 1]
[1, 1, 1, 0, 1]
[0, 0, 0, 0, 1]
[0, 0, 0, 0, 1]

121.1 Java Solution

public int[][] findPath(int[][] matrix){


int m = [Link];

int[][] result = new int[m][m];

ArrayList<int[]> temp = new ArrayList<int[]>();


ArrayList<int[]> list = new ArrayList<int[]>();

dfs(matrix, 0, 0, temp, list);

for(int i=0; i<[Link](); i++){


result[[Link](i)[0]][[Link](i)[1]]=1;
//[Link]([Link]([Link](i)));
}

result[0][0]=1;

return result;
}

public void dfs(int[][] matrix, int i, int j,


ArrayList<int[]> temp, ArrayList<int[]> list){

int m=[Link];

if(i==m-1 && j==m-1){

226 | 568
121 Find a Path in a Matrix

[Link]();
[Link](temp);
return;
}

int[] dx = {-1, 0, 1, 0};


int[] dy = {0, 1, 0, -1};

for(int k=0; k<4; k++){


int x = i+dx[k];
int y = j+dy[k];

if(x>=0&&y>=0&&x<=m-1&&y<=m-1 && matrix[x][y]==1){


[Link](new int[]{x,y});
int prev = matrix[x][y];
matrix[x][y]=0;

dfs(matrix, x, y, temp, list);

matrix[x][y]=prev;
[Link]([Link]()-1);
}
}
}

Program Creek 227 | 568


122 Sudoku Solver
Write a program to solve a Sudoku puzzle by filling the empty cells.

122.1 Java Solution

public void solveSudoku(char[][] board) {


helper(board);
}

private boolean helper(char[][] board){


for(int i=0; i<9; i++){
for(int j=0; j<9; j++){
if(board[i][j]!=’.’){
continue;
}

for(char k=’1’; k<=’9’; k++){


board[i][j]=k;
if(isValid(board, i, j) && helper(board)){
return true;
}
board[i][j]=’.’;
}

return false;
}
}

return true; //return true if all cells are checked


}

private boolean isValid(char[][] board, int i, int j){


HashSet<Character> set = new HashSet<>();

for(int k=0; k<9; k++){


if([Link](board[i][k])){
return false;
}
if(board[i][k]!=’.’){
[Link](board[i][k]);
}

[Link]();

for(int k=0; k<9; k++){


if([Link](board[k][j])){
return false;

228 | 568
122 Sudoku Solver

}
if(board[k][j]!=’.’){
[Link](board[k][j]);
}
}

[Link]();

int x=i/3 * 3;
int y=j/3 * 3;
for(int m=x; m<x+3; m++){
for(int n=y; n<y+3; n++){
if([Link](board[m][n])){
return false;
}
if(board[m][n]!=’.’){
[Link](board[m][n]);
}
}
}

[Link]();

return true;
}

122.2 Improved Version

public void solveSudoku(char[][] board) {


helper(board);
}

private boolean helper(char[][] board) {


for (int i = 0; i < 9; i++) {
for (int j = 0; j < 9; j++) {
if (board[i][j] != ’.’) {
continue;
}

for (char k = ’1’; k <= ’9’; k++) {


if (isValid(board, i, j, k)) {
board[i][j] = k;
if (helper(board)) {
return true;
}
board[i][j] = ’.’;
}
}
return false;
}
}

return true; //return true if all cells are checked


}

Program Creek 229 | 568


122 Sudoku Solver

private boolean isValid(char[][] board, int row, int col, char c) {


for (int i = 0; i < 9; i++) {
if (board[i][col] != ’.’ && board[i][col] == c) {
return false;
}

if (board[row][i] != ’.’ && board[row][i] == c) {


return false;
}

if (board[3 * (row / 3) + i / 3][3 * (col / 3) + i % 3] != ’.’


&&
board[3 * (row / 3) + i / 3][3 * (col / 3) + i % 3] == c) {
return false;
}
}
return true;
}

The time complexity is O(9m̂) where m represents the number of blanks to be filled. No extra space is needed.

Program Creek 230 | 568


123 Valid Sudoku
Determine if a Sudoku is valid. The Sudoku board could be partially filled, where empty cells are filled with the
character ’.’.

123.1 Java Solution

public boolean isValidSudoku(char[][] board) {


if (board == null || [Link] != 9 || board[0].length != 9)
return false;
// check each column
for (int i = 0; i < 9; i++) {
boolean[] m = new boolean[9];
for (int j = 0; j < 9; j++) {
if (board[i][j] != ’.’) {
if (m[(int) (board[i][j] - ’1’)]) {
return false;
}
m[(int) (board[i][j] - ’1’)] = true;
}
}
}

//check each row


for (int j = 0; j < 9; j++) {
boolean[] m = new boolean[9];
for (int i = 0; i < 9; i++) {
if (board[i][j] != ’.’) {
if (m[(int) (board[i][j] - ’1’)]) {
return false;

231 | 568
123 Valid Sudoku

}
m[(int) (board[i][j] - ’1’)] = true;
}
}
}

//check each 3*3 matrix


for (int block = 0; block < 9; block++) {
boolean[] m = new boolean[9];
for (int i = block / 3 * 3; i < block / 3 * 3 + 3; i++) {
for (int j = block % 3 * 3; j < block % 3 * 3 + 3; j++) {
if (board[i][j] != ’.’) {
if (m[(int) (board[i][j] - ’1’)]) {
return false;
}
m[(int) (board[i][j] - ’1’)] = true;
}
}
}
}

return true;
}

Program Creek 232 | 568


124 Walls and Gates

124.1 Java Solution 1 - DFS

public void wallsAndGates(int[][] rooms) {


if(rooms==null || [Link]==0||rooms[0].length==0)
return;

int m = [Link];
int n = rooms[0].length;

boolean[][] visited = new boolean[m][n];

for(int i=0; i<m; i++){


for(int j=0; j<n; j++){
if(rooms[i][j]==0){
fill(rooms, i-1, j, 0, visited);
fill(rooms, i, j+1, 0, visited);
fill(rooms, i+1, j, 0, visited);
fill(rooms, i, j-1, 0, visited);
visited = new boolean[m][n];
}
}
}
}

public void fill(int[][] rooms, int i, int j, int start, boolean[][] visited){
int m=[Link];
int n=rooms[0].length;

if(i<0||i>=m||j<0||j>=n||rooms[i][j]<=0||visited[i][j]){
return;
}

rooms[i][j] = [Link](rooms[i][j], start+1);


visited[i][j]=true;

fill(rooms, i-1, j, start+1, visited);


fill(rooms, i, j+1, start+1, visited);
fill(rooms, i+1, j, start+1, visited);
fill(rooms, i, j-1, start+1, visited);

visited[i][j]=false;
}

The DFS solution can be simplified as the following:

public void wallsAndGates(int[][] rooms) {


if(rooms==null || [Link]==0||rooms[0].length==0)
return;

233 | 568
124 Walls and Gates

int m = [Link];
int n = rooms[0].length;

for(int i=0; i<m; i++){


for(int j=0; j<n; j++){
if(rooms[i][j]==0){
fill(rooms, i, j, 0);
}
}
}
}

public void fill(int[][] rooms, int i, int j, int distance){


int m=[Link];
int n=rooms[0].length;

if(i<0||i>=m||j<0||j>=n||rooms[i][j]<distance){
return;
}

rooms[i][j] = distance;

fill(rooms, i-1, j, distance+1);


fill(rooms, i, j+1, distance+1);
fill(rooms, i+1, j, distance+1);
fill(rooms, i, j-1, distance+1);
}

124.2 Java Solution 2 - BFS

public void wallsAndGates(int[][] rooms) {


if(rooms==null || [Link]==0||rooms[0].length==0)
return;

int m = [Link];
int n = rooms[0].length;

LinkedList<Integer> queue = new LinkedList<Integer>();

for(int i=0; i<m; i++){


for(int j=0; j<n; j++){
if(rooms[i][j]==0){
[Link](i*n+j);
}
}
}

while(![Link]()){
int head = [Link]();
int x=head/n;
int y=head%n;

if(x>0 && rooms[x-1][y]==Integer.MAX_VALUE){


rooms[x-1][y]=rooms[x][y]+1;
[Link]((x-1)*n+y);

Program Creek 234 | 568


124 Walls and Gates

if(x<m-1 && rooms[x+1][y]==Integer.MAX_VALUE){


rooms[x+1][y]=rooms[x][y]+1;
[Link]((x+1)*n+y);
}

if(y>0 && rooms[x][y-1]==Integer.MAX_VALUE){


rooms[x][y-1]=rooms[x][y]+1;
[Link](x*n+y-1);
}

if(y<n-1 && rooms[x][y+1]==Integer.MAX_VALUE){


rooms[x][y+1]=rooms[x][y]+1;
[Link](x*n+y+1);
}
}
}

Program Creek 235 | 568


125 Surrounded Regions
Given a 2D board containing ’X’ and ’O’, capture all regions surrounded by ’X’. A region is captured by flipping
all ’O’s into ’X’s in that surrounded region.
For example,

X X X X
X O O X
X X O X
X O X X

After running your function, the board should be:

X X X X
X X X X
X X X X
X O X X

125.1 Analysis
This problem is similar to Number of Islands. In this problem, only the cells on the boarders can not be sur-
rounded. So we can first merge those O’s on the boarders like in Number of Islands and replace O’s with ’#’, and
then scan the board and replace all O’s left (if any).

125.2 Depth-first Search

public void solve(char[][] board) {


if(board == null || [Link]==0)
return;

int m = [Link];
int n = board[0].length;

//merge O’s on left & right boarder


for(int i=0;i<m;i++){
if(board[i][0] == ’O’){
merge(board, i, 0);
}

if(board[i][n-1] == ’O’){
merge(board, i, n-1);
}
}

//merge O’s on top & bottom boarder


for(int j=0; j<n; j++){
if(board[0][j] == ’O’){
merge(board, 0, j);

236 | 568
125 Surrounded Regions

if(board[m-1][j] == ’O’){
merge(board, m-1, j);
}
}

//process the board


for(int i=0;i<m;i++){
for(int j=0; j<n; j++){
if(board[i][j] == ’O’){
board[i][j] = ’X’;
}else if(board[i][j] == ’#’){
board[i][j] = ’O’;
}
}
}
}

public void merge(char[][] board, int i, int j){


board[i][j] = ’#’;

int[] dx = {-1, 0, 1, 0};


int[] dy = {0, 1, 0, -1};

for(int k=0; k<4; k++){


int x = i+dx[k];
int y = j+dy[k];

if(x>=0 && x<[Link]


&& y>=0 && y<board[0].length
&& board[x][y]==’O’){
merge(board, x, y);
}
}
}

125.3 Breath-first Search


We can also use a queue to do breath-first search for this problem.

public void solve(char[][] board) {


if(board==null || [Link]==0 || board[0].length==0)
return;

int m=[Link];
int n=board[0].length;

for(int j=0; j<n; j++){


if(board[0][j]==’O’){
bfs(board, 0, j);
}
}

for(int j=0; j<n; j++){

Program Creek 237 | 568


125 Surrounded Regions

if(board[m-1][j]==’O’){
bfs(board, m-1, j);
}
}

for(int i=0; i<m; i++){


if(board[i][0]==’O’){
bfs(board, i, 0);
}
}

for(int i=0; i<m; i++){


if(board[i][n-1]==’O’){
bfs(board, i, n-1);
}
}

for(int i=0; i<m; i++){


for(int j=0; j<n; j++){
if(board[i][j]==’O’){
board[i][j]=’X’;
}
if(board[i][j]==’1’){
board[i][j]=’O’;
}
}
}
}

public void bfs(char[][] board, int o, int p){


int m=[Link];
int n=board[0].length;

int index = o*n+p;


LinkedList<Integer> queue = new LinkedList<Integer>();
[Link](index);
board[o][p]=’1’;

while(![Link]()){
int top = [Link]();
int i=top/n;
int j=top%n;

if(i-1>=0 && board[i-1][j]==’O’){


board[i-1][j]=’1’;
[Link]((i-1)*n+j);
}
if(i+1<m && board[i+1][j]==’O’){
board[i+1][j]=’1’;
[Link]((i+1)*n+j);
}
if(j-1>=0 && board[i][j-1]==’O’){
board[i][j-1]=’1’;
[Link](i*n+j-1);
}
if(j+1<n && board[i][j+1]==’O’){
board[i][j+1]=’1’;
[Link](i*n+j+1);

Program Creek 238 | 568


125 Surrounded Regions

}
}
}

Program Creek 239 | 568


126 Set Matrix Zeroes
Given a m * n matrix, if an element is 0, set its entire row and column to 0. Do it in place.

126.1 Analysis
This problem should be solved in place, i.e., no other array should be used. We can use the first column and the
first row to track if a row/column should be set to 0.
Since we used the first row and first column to mark the zero row/column, the original values are changed.

Step 1: First row contains zero = true; First column contains zero = false;

240 | 568
126 Set Matrix Zeroes

126.2 Java Solution

public class Solution {


public void setZeroes(int[][] matrix) {
boolean firstRowZero = false;
boolean firstColumnZero = false;

//set first row and column zero or not


for(int i=0; i<[Link]; i++){
if(matrix[i][0] == 0){
firstColumnZero = true;
break;
}
}

for(int i=0; i<matrix[0].length; i++){


if(matrix[0][i] == 0){
firstRowZero = true;
break;
}
}

//mark zeros on first row and column

Program Creek 241 | 568


126 Set Matrix Zeroes

for(int i=1; i<[Link]; i++){


for(int j=1; j<matrix[0].length; j++){
if(matrix[i][j] == 0){
matrix[i][0] = 0;
matrix[0][j] = 0;
}
}
}

//use mark to set elements


for(int i=1; i<[Link]; i++){
for(int j=1; j<matrix[0].length; j++){
if(matrix[i][0] == 0 || matrix[0][j] == 0){
matrix[i][j] = 0;
}
}
}

//set first column and row


if(firstColumnZero){
for(int i=0; i<[Link]; i++)
matrix[i][0] = 0;
}

if(firstRowZero){
for(int i=0; i<matrix[0].length; i++)
matrix[0][i] = 0;
}

}
}

Program Creek 242 | 568


127 Spiral Matrix
Given a matrix of m x n elements (m rows, n columns), return all elements of the matrix in spiral order.
For example, given the following matrix:

[
[ 1, 2, 3 ],
[ 4, 5, 6 ],
[ 7, 8, 9 ]
]

You should return [1,2,3,6,9,8,7,4,5].

127.1 Java Solution 1


If more than one row and column left, it can form a circle and we process the circle. Otherwise, if only one row
or column left, we process that column or row ONLY.

public class Solution {


public ArrayList<Integer> spiralOrder(int[][] matrix) {
ArrayList<Integer> result = new ArrayList<Integer>();

if(matrix == null || [Link] == 0) return result;

int m = [Link];
int n = matrix[0].length;

int x=0;
int y=0;

while(m>0 && n>0){

//if one row/column left, no circle can be formed


if(m==1){
for(int i=0; i<n; i++){
[Link](matrix[x][y++]);
}
break;
}else if(n==1){
for(int i=0; i<m; i++){
[Link](matrix[x++][y]);
}
break;
}

//below, process a circle

//top - move right


for(int i=0;i<n-1;i++){
[Link](matrix[x][y++]);
}

243 | 568
127 Spiral Matrix

//right - move down


for(int i=0;i<m-1;i++){
[Link](matrix[x++][y]);
}

//bottom - move left


for(int i=0;i<n-1;i++){
[Link](matrix[x][y--]);
}

//left - move up
for(int i=0;i<m-1;i++){
[Link](matrix[x--][y]);
}

x++;
y++;
m=m-2;
n=n-2;
}

return result;
}
}

Similarly, we can write the solution this way:

public List<Integer> spiralOrder(int[][] matrix) {


List<Integer> result = new ArrayList<Integer>();
if(matrix==null||[Link]==0||matrix[0].length==0)
return result;

int m = [Link];
int n = matrix[0].length;

int left=0;
int right=n-1;
int top = 0;
int bottom = m-1;

while([Link]()<m*n){
for(int j=left; j<=right; j++){
[Link](matrix[top][j]);
}
top++;

for(int i=top; i<=bottom; i++){


[Link](matrix[i][right]);
}
right--;

//prevent duplicate row


if(bottom<top)
break;

for(int j=right; j>=left; j--){


[Link](matrix[bottom][j]);

Program Creek 244 | 568


127 Spiral Matrix

}
bottom--;

// prevent duplicate column


if(right<left)
break;

for(int i=bottom; i>=top; i--){


[Link](matrix[i][left]);
}
left++;
}

return result;
}

127.2 Java Solution 2


We can also recursively solve this problem. The solution’s performance is not better than Solution 1. Therefore,
Solution 1 should be preferred.

public class Solution {


public ArrayList<Integer> spiralOrder(int[][] matrix) {
if(matrix==null || [Link]==0)
return new ArrayList<Integer>();

return spiralOrder(matrix,0,0,[Link],matrix[0].length);
}

public ArrayList<Integer> spiralOrder(int [][] matrix, int x, int y, int m, int n){
ArrayList<Integer> result = new ArrayList<Integer>();

if(m<=0||n<=0)
return result;

//only one element left


if(m==1&&n==1) {
[Link](matrix[x][y]);
return result;
}

//top - move right


for(int i=0;i<n-1;i++){
[Link](matrix[x][y++]);
}

//right - move down


for(int i=0;i<m-1;i++){
[Link](matrix[x++][y]);
}

//bottom - move left


if(m>1){
for(int i=0;i<n-1;i++){
[Link](matrix[x][y--]);

Program Creek 245 | 568


127 Spiral Matrix

}
}

//left - move up
if(n>1){
for(int i=0;i<m-1;i++){
[Link](matrix[x--][y]);
}
}

if(m==1||n==1)
[Link](spiralOrder(matrix, x, y, 1, 1));
else
[Link](spiralOrder(matrix, x+1, y+1, m-2, n-2));

return result;
}
}

Program Creek 246 | 568


128 Spiral Matrix II
Given an integer n, generate a square matrix filled with elements from 1 to n2̂ in spiral order. For example, given
n = 4,

[
[1, 2, 3, 4],
[12, 13, 14, 5],
[11, 16, 15, 6],
[10, 9, 8, 7]
]

128.1 Java Solution 1

public int[][] generateMatrix(int n) {


int total = n*n;
int[][] result= new int[n][n];

int x=0;
int y=0;
int step = 0;

for(int i=0;i<total;){
while(y+step<n){
i++;
result[x][y]=i;
y++;

}
y--;
x++;

while(x+step<n){
i++;
result[x][y]=i;
x++;
}
x--;
y--;

while(y>=0+step){
i++;
result[x][y]=i;
y--;
}
y++;
x--;
step++;

while(x>=0+step){

247 | 568
128 Spiral Matrix II

i++;
result[x][y]=i;
x--;
}
x++;
y++;
}

return result;
}

128.2 Java Solution 2

public int[][] generateMatrix(int n) {


int[][] result = new int[n][n];

int k=1;
int top=0;
int bottom=n-1;
int left=0;
int right=n-1;

while(k<=n*n){
for(int i=left; i<=right; i++){
result[top][i]=k;
k++;
}
top++;

for(int i=top; i<=bottom; i++){


result[i][right]=k;
k++;
}
right--;

for(int i=right; i>=left; i--){


result[bottom][i]=k;
k++;
}
bottom--;

for(int i=bottom; i>=top; i--){


result[i][left] = k;
k++;
}
left++;
}

return result;
}

Program Creek 248 | 568


129 Rotate Image
You are given an n x n 2D matrix representing an image.
Rotate the image by 90 degrees (clockwise).
Follow up: Could you do this in-place?

129.1 In-place Solution


By using the relation "matrix[i][j] = matrix[n-1-j][i]", we can loop through the matrix.

public void rotate(int[][] matrix) {


int n = [Link];
for (int i = 0; i < n / 2; i++) {
for (int j = 0; j < [Link](((double) n) / 2.); j++) {
int temp = matrix[i][j];
matrix[i][j] = matrix[n-1-j][i];
matrix[n-1-j][i] = matrix[n-1-i][n-1-j];
matrix[n-1-i][n-1-j] = matrix[j][n-1-i];
matrix[j][n-1-i] = temp;
}
}
}

249 | 568
130 Range Sum Query 2D Immutable
Given a 2D matrix matrix, find the sum of the elements inside the rectangle defined by its upper left corner (row1,
col1) and lower right corner (row2, col2).

130.1 Analysis
Since the assumption is that there are many calls to sumRegion method, we should use some extra space to store
the intermediate results.
The solution is similar to other sum related problems such as . The basic idea is demonstrated in the following
example:

250 | 568
130 Range Sum Query 2D Immutable

[Pleaseinsert\PrerenderUnicode{âĂŞ}intopreamble]-[Link]

./figures/Range-Sum-Query-2D-\begingroup \let \relax \relax \endgroup [Pleaseinsert\PrerenderUnicode{âĂŞ}

Here we define an array sum[][] which stores the sum value from (0,0) to the current cell.

130.2 Java Solution

public class NumMatrix {


int [][] sum;

Program Creek 251 | 568


130 Range Sum Query 2D Immutable

public NumMatrix(int[][] matrix) {


if(matrix==null || [Link]==0||matrix[0].length==0)
return;

int m = [Link];
int n = matrix[0].length;
sum = new int[m][n];

for(int i=0; i<m; i++){


int sumRow=0;
for(int j=0; j<n; j++){
if(i==0){
sumRow += matrix[i][j];
sum[i][j]=sumRow;
}else{
sumRow += matrix[i][j];
sum[i][j]=sumRow+sum[i-1][j];
}

}
}
}

public int sumRegion(int row1, int col1, int row2, int col2) {
if([Link]==null)
return 0;

int topRightX = row1;


int topRightY = col2;

int bottomLeftX=row2;
int bottomLeftY= col1;

int result=0;

if(row1==0 && col1==0){


result = sum[row2][col2];
}else if(row1==0){
result = sum[row2][col2]
-sum[bottomLeftX][bottomLeftY-1];

}else if(col1==0){
result = sum[row2][col2]
-sum[topRightX-1][topRightY];
}else{
result = sum[row2][col2]
-sum[topRightX-1][topRightY]
-sum[bottomLeftX][bottomLeftY-1]
+sum[row1-1][col1-1];
}

return result;
}
}

Program Creek 252 | 568


131 Shortest Distance from All Buildings
You want to build a house on an empty land which reaches all buildings in the shortest amount of distance. You
can only move up, down, left and right. You are given a 2D grid of values 0, 1 or 2, where:
Each 0 marks an empty land which you can pass by freely. Each 1 marks a building which you cannot pass
through. Each 2 marks an obstacle which you cannot pass through.
For example, given three buildings at (0,0), (0,4), (2,2), and an obstacle at (0,2). The point (1,2) is an ideal empty
land to build a house, as the total travel distance of 3+3+1=7 is minimal. So return 7.

131.1 Java Solution


This problem can be solve by BFS. We define one matrix for tracking the distance from each building, and another
matrix for tracking the number of buildings which can be reached.

public class Solution {

int[][] numReach;
int[][] distance;

public int shortestDistance(int[][] grid) {


if(grid==null||[Link]==0||grid[0].length==0)
return 0;

int m = [Link];
int n = grid[0].length;

numReach = new int[m][n];


distance = new int[m][n];

int numBuilding = 0;
for(int i=0; i<m; i++){
for(int j=0; j<n; j++){
if(grid[i][j]==1){
boolean[][] visited = new boolean[m][n];
LinkedList<Integer> queue = new LinkedList<Integer>();
bfs(grid, i, j, i, j, 0, visited, queue);

numBuilding++;
}
}
}

int result=Integer.MAX_VALUE;
for(int i=0; i<m; i++){
for(int j=0; j<n; j++){
if(grid[i][j] == 0 && numReach[i][j]==numBuilding){
result = [Link](result, distance[i][j]);

}
}

253 | 568
131 Shortest Distance from All Buildings

return result == Integer.MAX_VALUE ? -1 : result;


}

public void bfs(int[][] grid, int ox, int oy, int i, int j,
int distanceSoFar, boolean[][] visited, LinkedList<Integer> queue){

visit(grid, i, j, i, j, distanceSoFar, visited, queue);


int n = grid[0].length;

while(![Link]()){
int size = [Link]();
distanceSoFar++;

for(int k=0; k<size; k++){


int top = [Link]();
i=top/n;
j=top%n;

visit(grid, ox, oy, i-1, j, distanceSoFar, visited, queue);


visit(grid, ox, oy, i+1, j, distanceSoFar, visited, queue);
visit(grid, ox, oy, i, j-1, distanceSoFar, visited, queue);
visit(grid, ox, oy, i, j+1, distanceSoFar, visited, queue);
}

}
}

public void visit(int[][] grid, int ox, int oy, int i, int j, int distanceSoFar, boolean[][] visited,
LinkedList<Integer> queue){
int m = [Link];
int n = grid[0].length;

if(i<0 || i>=m || j<0 || j>=n || visited[i][j])


return;

if((i!=ox || j!=oy) && grid[i][j]!=0){


return;
}

visited[i][j]=true;
numReach[i][j]++;
distance[i][j]+= distanceSoFar;
[Link](i*n+j);
}
}

Program Creek 254 | 568


132 Best Meeting Point
A group of two or more people wants to meet and minimize the total travel distance. You are given a 2D grid of
values 0 or 1, where each 1 marks the home of someone in the group. The distance is calculated using Manhattan
Distance, where distance(p1, p2) = |p2.x - p1.x| + |p2.y - p1.y|.
For example, given three people living at (0,0), (0,4), and (2,2):

1 - 0 - 0 - 0 - 1
| | | | |
0 - 0 - 0 - 0 - 0
| | | | |
0 - 0 - 1 - 0 - 0

The point (0,2) is an ideal meeting point, as the total travel distance of 2+2+2=6 is minimal. So return 6.

132.1 Java Solution


This problem is converted to find the median value on x-axis and y-axis.

public int minTotalDistance(int[][] grid) {


int m=[Link];
int n=grid[0].length;

ArrayList<Integer> cols = new ArrayList<Integer>();


ArrayList<Integer> rows = new ArrayList<Integer>();
for(int i=0; i<m; i++){
for(int j=0; j<n; j++){
if(grid[i][j]==1){
[Link](j);
[Link](i);
}
}
}

int sum=0;

for(Integer i: rows){
sum += [Link](i - [Link]([Link]()/2));
}

[Link](cols);

for(Integer i: cols){
sum+= [Link]([Link]([Link]()/2));
}

return sum;
}

255 | 568
133 Game of Life
Given a board with m by n cells, each cell has an initial state live (1) or dead (0). Each cell interacts with its eight
neighbors (horizontal, vertical, diagonal) using the following four rules:
Any live cell with fewer than two live neighbors dies, as if caused by under-population. Any live cell with two
or three live neighbors lives on to the next generation. Any live cell with more than three live neighbors dies, as
if by over-population.. Any dead cell with exactly three live neighbors becomes a live cell, as if by reproduction.
Write a function to compute the next state (after one update) of the board given its current state.

133.1 Java Solution 1


Because we need to solve the problem in place, we can use the higher bit to record the next state. And at the end,
shift right a bit to get the next state for each cell.

public void gameOfLife(int[][] board) {


if(board==null || [Link]==0||board[0].length==0)
return;

int m=[Link];
int n=board[0].length;

int[] x = {-1, -1, 0, 1, 1, 1, 0, -1};


int[] y = {0, 1, 1, 1, 0, -1, -1, -1};

for(int i=0; i<m; i++){


for(int j=0; j<n; j++){
int count=0;
for(int k=0; k<8; k++){
int nx=i+x[k];
int ny=j+y[k];
if(nx>=0&&nx<m&&ny>=0&&ny<n&&(board[nx][ny]&1)==1){
count++;
}
}

//<2 die
if(count<2){
board[i][j] &= 1;
}

//same state
if(count==2||count==3){
board[i][j] |= board[i][j]<<1;
}

//go live
if(count==3){
board[i][j] |=2;
}

//>3 die

256 | 568
133 Game of Life

if(count>3){
board[i][j] &=1;
}
}
}

for(int i=0; i<m; i++){


for(int j=0; j<n; j++){
board[i][j] = board[i][j]>>1;

}
}
}

Program Creek 257 | 568


134 TicTacToe
Design a Tic-tac-toe game that is played between two players on a n x n grid.

134.1 Java Solution 1 - Naive


We can simply check the row, column and the diagonals and see if there is a winner.

public class TicTacToe {

int[][] matrix;

/** Initialize your data structure here. */


public TicTacToe(int n) {
matrix = new int[n][n];
}

/** Player {player} makes a move at ({row}, {col}).


@param row The row of the board.
@param col The column of the board.
@param player The player, can be either 1 or 2.
@return The current winning condition, can be either:
0: No one wins.
1: Player 1 wins.
2: Player 2 wins. */
public int move(int row, int col, int player) {
matrix[row][col]=player;

//check row
boolean win=true;
for(int i=0; i<[Link]; i++){
if(matrix[row][i]!=player){
win=false;
break;
}
}

if(win) return player;

//check column
win=true;
for(int i=0; i<[Link]; i++){
if(matrix[i][col]!=player){
win=false;
break;
}
}

if(win) return player;

//check back diagonal

258 | 568
134 TicTacToe

win=true;
for(int i=0; i<[Link]; i++){
if(matrix[i][i]!=player){
win=false;
break;
}
}

if(win) return player;

//check forward diagonal


win=true;
for(int i=0; i<[Link]; i++){
if(matrix[i][[Link]-i-1]!=player){
win=false;
break;
}
}

if(win) return player;

return 0;
}
}

134.2 Java Solution 2

public class TicTacToe {


int[] rows;
int[] cols;
int dc1;
int dc2;
int n;
/** Initialize your data structure here. */
public TicTacToe(int n) {
this.n=n;
[Link]=new int[n];
[Link]=new int[n];
}

/** Player {player} makes a move at ({row}, {col}).


@param row The row of the board.
@param col The column of the board.
@param player The player, can be either 1 or 2.
@return The current winning condition, can be either:
0: No one wins.
1: Player 1 wins.
2: Player 2 wins. */
public int move(int row, int col, int player) {
int val = (player==1?1:-1);

rows[row]+=val;
cols[col]+=val;

if(row==col){

Program Creek 259 | 568


134 TicTacToe

dc1+=val;
}
if(col==n-row-1){
dc2+=val;
}

if([Link](rows[row])==n
|| [Link](cols[col])==n
|| [Link](dc1)==n
|| [Link](dc2)==n){
return player;
}

return 0;
}
}

Program Creek 260 | 568


135 Sparse Matrix Multiplication
Given two sparse matrices A and B, return the result of AB.
You may assume that A’s column number is equal to B’s row number.

135.1 Naive Method


We can implement Sum(A_ik * B_kj) ->C_ij as a naive solution.

public int[][] multiply(int[][] A, int[][] B) {


//validity check

int[][] C = new int[[Link]][B[0].length];

for(int i=0; i<[Link]; i++){


for(int j=0; j<C[0].length; j++){
int sum=0;
for(int k=0; k<A[0].length; k++){
sum += A[i][k]*B[k][j];
}
C[i][j] = sum;
}
}

return C;
}

Time complexity is O(n3̂).

135.2 Optimized Method


From the formula: Sum(A_ik * B_kj) ->C_ij
We can see that when A_ik is 0, there is no need to compute B_kj. So we switch the inner two loops and add a
0-checking condition.

public int[][] multiply(int[][] A, int[][] B) {


//validity check

int[][] C = new int[[Link]][B[0].length];

for(int i=0; i<[Link]; i++){


for(int k=0; k<A[0].length; k++){
if(A[i][k]!=0){
for(int j=0; j<C[0].length; j++){
C[i][j] += A[i][k]*B[k][j];
}
}
}
}

261 | 568
135 Sparse Matrix Multiplication

return C;
}

Since the matrix is sparse, time complexity is O(n2̂) which is much faster than O(n3̂).

Program Creek 262 | 568


136 Add Two Numbers
You are given two linked lists representing two non-negative numbers. The digits are stored in reverse order and
each of their nodes contain a single digit. Add the two numbers and return it as a linked list.
Input: (2 ->4 ->3) + (5 ->6 ->4) Output: 7 ->0 ->8

136.1 Java Solution

/*
2 -> 4 -> 3
5 -> 6 -> 4
7 0 8
*/
public ListNode addTwoNumbers(ListNode l1, ListNode l2) {
ListNode fake = new ListNode(0);
ListNode p = fake;

ListNode p1 = l1;
ListNode p2 = l2;

int carry = 0;
while(p1!=null || p2!=null){
int sum = carry;
if(p1!=null){
sum += [Link];
p1 = [Link];
}

if(p2!=null){
sum += [Link];
p2 = [Link];
}

if(sum>9){
carry=1;
sum = sum-10;
}else{
carry = 0;
}

ListNode l = new ListNode(sum);


[Link] = l;
p = [Link];
}

//don’t forget check the carry value at the end


if(carry > 0){
ListNode l = new ListNode(carry);
[Link] = l;
}

263 | 568
136 Add Two Numbers

return [Link];
}

What if the digits are stored in regular order instead of reversed order?
Answer: We can simple reverse the list, calculate the result, and reverse the result.

Program Creek 264 | 568


137 Reorder List
Given a singly linked list L: L0→L1→ ... →Ln-1→Ln, reorder it to: L0→Ln→L1→Ln-1→L2→Ln-2→...
For example, given 1,2,3,4, reorder it to 1,4,2,3. You must do this in-place without altering the nodes’ values.

137.1 Java Solution Because the problem requires "in-place"


operations, we can only change their pointers, not creating a
new list. This problem can be solved by doing the following 3
steps:
• Break list in the middle to two lists (use fast & slow pointers)
• Reverse the order of the second list
• Merge two list back together

The following code is a complete runnable class with testing.

//Class definition of ListNode


class ListNode {
int val;
ListNode next;

ListNode(int x) {
val = x;
next = null;
}
}

public class ReorderList {

public static void main(String[] args) {


ListNode n1 = new ListNode(1);
ListNode n2 = new ListNode(2);
ListNode n3 = new ListNode(3);
ListNode n4 = new ListNode(4);
[Link] = n2;
[Link] = n3;
[Link] = n4;

printList(n1);

reorderList(n1);

printList(n1);
}

public static void reorderList(ListNode head) {

if (head != null && [Link] != null) {

265 | 568
137 Reorder List

ListNode slow = head;


ListNode fast = head;

//use a fast and slow pointer to break the link to two parts.
while (fast != null && [Link] != null && [Link]!= null) {
//why need third/second condition?
[Link]("pre "+[Link] + " " + [Link]);
slow = [Link];
fast = [Link];
[Link]("after " + [Link] + " " + [Link]);
}

ListNode second = [Link];


[Link] = null;// need to close first part

// now should have two lists: head and fast

// reverse order for second part


second = reverseOrder(second);

ListNode p1 = head;
ListNode p2 = second;

//merge two lists here


while (p2 != null) {
ListNode temp1 = [Link];
ListNode temp2 = [Link];

[Link] = p2;
[Link] = temp1;

p1 = temp1;
p2 = temp2;
}
}
}

public static ListNode reverseOrder(ListNode head) {

if (head == null || [Link] == null) {


return head;
}

ListNode pre = head;


ListNode curr = [Link];

while (curr != null) {


ListNode temp = [Link];
[Link] = pre;
pre = curr;
curr = temp;
}

// set head node’s next


[Link] = null;

return pre;
}

Program Creek 266 | 568


137 Reorder List

public static void printList(ListNode n) {


[Link]("------");
while (n != null) {
[Link]([Link]);
n = [Link];
}
[Link]();
}
}

137.2 Takeaway Messages


The three steps can be used to solve other problems of linked list. The following diagrams illustrate how each of
the steps works.
Reverse List:

Merge List:

Program Creek 267 | 568


137 Reorder List

Note that pointers movements always starts with assigning the next node to a temporary variable t.

Program Creek 268 | 568


138 Linked List Cycle
Given a linked list, determine if it has a cycle in it.

138.1 Analysis
If we have 2 pointers - fast and slow. It is guaranteed that the fast one will meet the slow one if there exists a
circle.

138.2 Java Solution

public class Solution {


public boolean hasCycle(ListNode head) {
ListNode fast = head;
ListNode slow = head;

while(fast != null && [Link] != null){


slow = [Link];
fast = [Link];

if(slow == fast)
return true;
}

return false;
}
}

269 | 568
139 Copy List with Random Pointer
A linked list is given such that each node contains an additional random pointer which could point to any node
in the list or null.
Return a deep copy of the list.

139.1 Java Solution 1


We can solve this problem by doing the following steps:
• copy every node, i.e., duplicate every node, and insert it to the list
• copy random pointers for all newly created nodes
• break the list to two

public RandomListNode copyRandomList(RandomListNode head) {

if (head == null)
return null;

RandomListNode p = head;

// copy every node and insert to list


while (p != null) {
RandomListNode copy = new RandomListNode([Link]);
[Link] = [Link];
[Link] = copy;
p = [Link];
}

// copy random pointer for each new node


p = head;
while (p != null) {
if ([Link] != null)
[Link] = [Link];
p = [Link];
}

// break list to two


p = head;
RandomListNode newHead = [Link];
while (p != null) {
RandomListNode temp = [Link];
[Link] = [Link];
if ([Link] != null)
[Link] = [Link];
p = [Link];
}

return newHead;
}

270 | 568
139 Copy List with Random Pointer

The break list part above move pointer 2 steps each time, you can also move one at a time which is simpler, like
the following:

while(p != null && [Link] != null){


RandomListNode temp = [Link];
[Link] = [Link];
p = temp;
}

139.2 Java Solution 2 - Using HashMap


From Xiaomeng’s comment below, we can use a HashMap which makes it simpler.

public RandomListNode copyRandomList(RandomListNode head) {


if (head == null)
return null;
HashMap<RandomListNode, RandomListNode> map = new HashMap<RandomListNode, RandomListNode>();
RandomListNode newHead = new RandomListNode([Link]);

RandomListNode p = head;
RandomListNode q = newHead;
[Link](head, newHead);

p = [Link];
while (p != null) {
RandomListNode temp = new RandomListNode([Link]);
[Link](p, temp);
[Link] = temp;
q = temp;
p = [Link];
}

p = head;
q = newHead;
while (p != null) {
if ([Link] != null)
[Link] = [Link]([Link]);
else
[Link] = null;

p = [Link];
q = [Link];
}

return newHead;
}

Program Creek 271 | 568


140 Merge Two Sorted Lists
Merge two sorted linked lists and return it as a new list. The new list should be made by splicing together the
nodes of the first two lists.

140.1 Analysis
The key to solve the problem is defining a fake head. Then compare the first elements from each list. Add the
smaller one to the merged list. Finally, when one of them is empty, simply append it to the merged list, since it
is already sorted.

140.2 Java Solution

public ListNode mergeTwoLists(ListNode l1, ListNode l2) {


ListNode head = new ListNode(0);
ListNode p = head;

while(l1!=null||l2!=null){
if(l1!=null&&l2!=null){
if([Link] < [Link]){
[Link] = l1;
l1=[Link];
}else{
[Link]=l2;
l2=[Link];
}
p = [Link];
}else if(l1==null){
[Link] = l2;
break;
}else if(l2==null){
[Link] = l1;
break;
}
}

return [Link];
}

Or write this way:

public ListNode mergeTwoLists(ListNode l1, ListNode l2) {


ListNode head = new ListNode(0);
ListNode p=head;

ListNode p1=l1;
ListNode p2=l2;
while(p1!=null && p2!=null){
if([Link] < [Link]){

272 | 568
140 Merge Two Sorted Lists

[Link] = p1;
p1 = [Link];
}else{
[Link] = p2;
p2 = [Link];
}
p=[Link];
}

if(p1!=null){
[Link] = p1;
}

if(p2!=null){
[Link] = p2;
}

return [Link];
}

Program Creek 273 | 568


141 Odd Even Linked List

141.1 Problem
Given a singly linked list, group all odd nodes together followed by the even nodes. Please note here we are
talking about the node number and not the value in the nodes.
The program should run in O(1) space complexity and O(nodes) time complexity.
Example:

Given 1->2->3->4->5->NULL,
return 1->3->5->2->4->NULL.

141.2 Analysis
This problem can be solved by using two pointers. We iterate over the link and move the two pointers.

141.3 Java Solution

public ListNode oddEvenList(ListNode head) {


if(head == null)
return head;

ListNode result = head;


ListNode p1 = head;
ListNode p2 = [Link];
ListNode connectNode = [Link];

while(p1 != null && p2 != null){


ListNode t = [Link];
if(t == null)
break;

274 | 568
141 Odd Even Linked List

[Link] = [Link];
p1 = [Link];

[Link] = [Link];
p2 = [Link];
}

[Link] = connectNode;

return result;
}

Program Creek 275 | 568


142 Remove Duplicates from Sorted List
Given a sorted linked list, delete all duplicates such that each element appear only once.
For example,

Given 1->1->2, return 1->2.


Given 1->1->2->3->3, return 1->2->3.

142.1 Thoughts
The key of this problem is using the right loop condition. And change what is necessary in each loop. You can
use different iteration conditions like the following 2 solutions.

142.2 Solution 1

/**
* Definition for singly-linked list.
* public class ListNode {
* int val;
* ListNode next;
* ListNode(int x) {
* val = x;
* next = null;
* }
* }
*/
public class Solution {
public ListNode deleteDuplicates(ListNode head) {
if(head == null || [Link] == null)
return head;

ListNode prev = head;


ListNode p = [Link];

while(p != null){
if([Link] == [Link]){
[Link] = [Link];
p = [Link];
//no change prev
}else{
prev = p;
p = [Link];
}
}

return head;
}
}

276 | 568
142 Remove Duplicates from Sorted List

142.3 Solution 2

public class Solution {


public ListNode deleteDuplicates(ListNode head) {
if(head == null || [Link] == null)
return head;

ListNode p = head;

while( p!= null && [Link] != null){


if([Link] == [Link]){
[Link] = [Link];
}else{
p = [Link];
}
}

return head;
}
}

Program Creek 277 | 568


143 Remove Duplicates from Sorted List II
Given a sorted linked list, delete all nodes that have duplicate numbers, leaving only distinct numbers from the
original list.
For example, given 1->1->1->2->3, return 2->3.

143.1 Java Solution

public ListNode deleteDuplicates(ListNode head) {


ListNode t = new ListNode(0);
[Link] = head;

ListNode p = t;
while([Link]!=null&&[Link]!=null){
if([Link] == [Link]){
int dup = [Link];
while([Link]!=null&&[Link]==dup){
[Link] = [Link];
}
}else{
p=[Link];
}

return [Link];
}

278 | 568
144 Partition List
Given a linked list and a value x, partition it such that all nodes less than x come before nodes greater than or
equal to x.
You should preserve the original relative order of the nodes in each of the two partitions.
For example, given 1->4->3->2->5->2 and x = 3, return 1->2->2->4->3->5.

144.1 Java Solution

public class Solution {


public ListNode partition(ListNode head, int x) {
if(head == null) return null;

ListNode fakeHead1 = new ListNode(0);


ListNode fakeHead2 = new ListNode(0);
[Link] = head;

ListNode p = head;
ListNode prev = fakeHead1;
ListNode p2 = fakeHead2;

while(p != null){
if([Link] < x){
p = [Link];
prev = [Link];
}else{

[Link] = p;
[Link] = [Link];

p = [Link];
p2 = [Link];
}
}

// close the list


[Link] = null;

[Link] = [Link];

return [Link];
}
}

279 | 568
145 Intersection of Two Linked Lists

145.1 Problem
Write a program to find the node at which the intersection of two singly linked lists begins.
For example, the following two linked lists:

A: a1 -> a2
->
c1 -> c2 -> c3
->
B: b1 -> b2 -> b3

begin to intersect at node c1.

145.2 Java Solution


First calculate the length of two lists and find the difference. Then start from the longer list at the diff offset,
iterate though 2 lists and find the node.

/**
* Definition for singly-linked list.
* public class ListNode {
* int val;
* ListNode next;
* ListNode(int x) {
* val = x;
* next = null;
* }
* }
*/
public class Solution {
public ListNode getIntersectionNode(ListNode headA, ListNode headB) {
int len1 = 0;
int len2 = 0;
ListNode p1=headA, p2=headB;
if (p1 == null || p2 == null)
return null;

while(p1 != null){
len1++;
p1 = [Link];
}
while(p2 !=null){
len2++;
p2 = [Link];
}

int diff = 0;
p1=headA;
p2=headB;

280 | 568
145 Intersection of Two Linked Lists

if(len1 > len2){


diff = len1-len2;
int i=0;
while(i<diff){
p1 = [Link];
i++;
}
}else{
diff = len2-len1;
int i=0;
while(i<diff){
p2 = [Link];
i++;
}
}

while(p1 != null && p2 != null){


if([Link] == [Link]){
return p1;
}else{

}
p1 = [Link];
p2 = [Link];
}

return null;
}
}

Program Creek 281 | 568


146 Remove Linked List Elements
Remove all elements from a linked list of integers that have value val.
Example

Given: 1 --> 2 --> 6 --> 3 --> 4 --> 5 --> 6, val = 6


Return: 1 --> 2 --> 3 --> 4 --> 5

146.1 Java Solution


The key to solve this problem is using a helper node to track the head of the list.

public ListNode removeElements(ListNode head, int val) {


ListNode helper = new ListNode(0);
[Link] = head;
ListNode p = helper;

while([Link] != null){
if([Link] == val){
ListNode next = [Link];
[Link] = [Link];
}else{
p = [Link];
}
}

return [Link];
}

282 | 568
147 Swap Nodes in Pairs
Given a linked list, swap every two adjacent nodes and return its head.
For example, given 1->2->3->4, you should return the list as 2->1->4->3.
Your algorithm should use only constant space. You may not modify the values in the list, only nodes itself can
be changed.

147.1 Java Solution 1


Use two template variable to track the previous and next node of each pair.

public ListNode swapPairs(ListNode head) {


if(head == null || [Link] == null)
return head;

ListNode h = new ListNode(0);


[Link] = head;
ListNode p = h;

while([Link] != null && [Link] != null){


//use t1 to track first node
ListNode t1 = p;
p = [Link];
[Link] = [Link];

//use t2 to track next node of the pair


ListNode t2 = [Link];
[Link] = p;
[Link] = t2;
}

return [Link];
}

147.2 Java Solution 2


Each time I do the same problem I often get the different solutions. Here is another way of writing this solution.

public ListNode swapPairs(ListNode head) {


if(head==null || [Link]==null)
return head;

//a fake head


ListNode h = new ListNode(0);
[Link] = head;

ListNode p1 = head;
ListNode p2 = [Link];

283 | 568
147 Swap Nodes in Pairs

ListNode pre = h;
while(p1!=null && p2!=null){
[Link] = p2;

ListNode t = [Link];
[Link] = p1;
pre = p1;
[Link] = t;

p1 = [Link];

if(t!=null)
p2 = [Link];
}

return [Link];
}

Program Creek 284 | 568


148 Reverse Linked List
Reverse a singly linked list.

148.1 Java Solution 1 - Iterative

public ListNode reverseList(ListNode head) {


if(head==null||[Link]==null)
return head;

ListNode p1 = head;
ListNode p2 = [Link];

[Link] = null;
while(p1!=null&& p2!=null){
ListNode t = [Link];
[Link] = p1;
p1 = p2;
p2 = t;
}

return p1;
}

148.2 Java Solution 2 - Recursive

public ListNode reverseList(ListNode head) {

285 | 568
148 Reverse Linked List

if(head==null || [Link] == null)


return head;

//get second node


ListNode second = [Link];
//set first’s next to be null
[Link] = null;

ListNode rest = reverseList(second);


[Link] = head;

return rest;
}

Program Creek 286 | 568


149 Reverse Linked List II
Reverse a linked list from position m to n. Do it in-place and in one-pass.
For example: given 1->2->3->4->5->NULL, m = 2 and n = 4, return 1->4->3->2->5->NULL.

149.1 Analysis

149.2 Java Solution

public ListNode reverseBetween(ListNode head, int m, int n) {


if(m==n) return head;

ListNode prev = null;//track (m-1)th node


ListNode first = new ListNode(0);//first’s next points to mth
ListNode second = new ListNode(0);//second’s next points to (n+1)th

int i=0;
ListNode p = head;
while(p!=null){
i++;
if(i==m-1){
prev = p;
}

if(i==m){
[Link] = p;
}

if(i==n){
[Link] = [Link];
[Link] = null;
}

p= [Link];
}
if([Link] == null)
return head;

// reverse list [m, n]


ListNode p1 = [Link];
ListNode p2 = [Link];
[Link] = [Link];

while(p1!=null && p2!=null){


ListNode t = [Link];
[Link] = p1;
p1 = p2;
p2 = t;
}

287 | 568
149 Reverse Linked List II

//connect to previous part


if(prev!=null)
[Link] = p1;
else
return p1;

return head;
}

Program Creek 288 | 568


150 Reverse Double Linked List
Given a double linked list’s head node, reverse the list and return the new head node.

150.1 Java Solution

/*
* For your reference:
*
* DoublyLinkedListNode {
* int data;
* DoublyLinkedListNode next;
* DoublyLinkedListNode prev;
* }
*
*/
static DoublyLinkedListNode reverse(DoublyLinkedListNode head) {
DoublyLinkedListNode p = head;
DoublyLinkedListNode newHead = head;

while(p!=null){
DoublyLinkedListNode t = [Link];
[Link] = [Link];
[Link] = t;

289 | 568
150 Reverse Double Linked List

newHead= p;
p = t;
}

return newHead;
}

Program Creek 290 | 568


151 Remove Nth Node From End of List
Given a linked list, remove the nth node from the end of list and return its head.
For example, given linked list 1->2->3->4->5 and n = 2, the result is 1->2->3->5.

151.1 Java Solution 1 - Naive Two Passes


Calculate the length first, and then remove the nth from the beginning.

public ListNode removeNthFromEnd(ListNode head, int n) {


if(head == null)
return null;

//get length of list


ListNode p = head;
int len = 0;
while(p != null){
len++;
p = [Link];
}

//if remove first node


int fromStart = len-n+1;
if(fromStart==1)
return [Link];

//remove non-first node


p = head;
int i=0;
while(p!=null){
i++;
if(i==fromStart-1){
[Link] = [Link];
}
p=[Link];
}

return head;
}

151.2 Java Solution 2 - One Pass


Use fast and slow pointers. The fast pointer is n steps ahead of the slow pointer. When the fast reaches the end,
the slow pointer points at the previous element of the target element.

public ListNode removeNthFromEnd(ListNode head, int n) {


if(head == null)
return null;

291 | 568
151 Remove Nth Node From End of List

ListNode fast = head;


ListNode slow = head;

for(int i=0; i<n; i++){


fast = [Link];
}

//if remove the first node


if(fast == null){
head = [Link];
return head;
}

while([Link] != null){
fast = [Link];
slow = [Link];
}

[Link] = [Link];

return head;
}

Program Creek 292 | 568


152 Palindrome Linked List
Given a singly linked list, determine if it is a palindrome.

152.1 Java Solution 1 - Creat a new reversed list


We can create a new list in reversed order and then compare each node. The time and space are O(n).

public boolean isPalindrome(ListNode head) {


if(head == null)
return true;

ListNode p = head;
ListNode prev = new ListNode([Link]);

while([Link] != null){
ListNode temp = new ListNode([Link]);
[Link] = prev;
prev = temp;
p = [Link];
}

ListNode p1 = head;
ListNode p2 = prev;

while(p1!=null){
if([Link] != [Link])
return false;

p1 = [Link];
p2 = [Link];
}

return true;
}

152.2 Java Solution 2 - Break and reverse second half


We can use a fast and slow pointer to get the center of the list, then reverse the second list and compare two
sublists. The time is O(n) and space is O(1).

public boolean isPalindrome(ListNode head) {

if(head == null || [Link]==null)


return true;

//find list center


ListNode fast = head;
ListNode slow = head;

293 | 568
152 Palindrome Linked List

while([Link]!=null && [Link]!=null){


fast = [Link];
slow = [Link];
}

ListNode secondHead = [Link];


[Link] = null;

//reverse second part of the list


ListNode p1 = secondHead;
ListNode p2 = [Link];

while(p1!=null && p2!=null){


ListNode temp = [Link];
[Link] = p1;
p1 = p2;
p2 = temp;
}

[Link] = null;

//compare two sublists now


ListNode p = (p2==null?p1:p2);
ListNode q = head;
while(p!=null){
if([Link] != [Link])
return false;

p = [Link];
q = [Link];

return true;
}

152.3 Java Solution 3 - Recursive

public class Solution {


ListNode left;

public boolean isPalindrome(ListNode head) {


left = head;

boolean result = helper(head);


return result;
}

public boolean helper(ListNode right){

//stop recursion
if (right == null)
return true;

Program Creek 294 | 568


152 Palindrome Linked List

//if sub-list is not palindrome, return false


boolean x = helper([Link]);
if (!x)
return false;

//current left and right


boolean y = ([Link] == [Link]);

//move left to next


left = [Link];

return y;
}
}

Time is O(n) and space is O(n).

Program Creek 295 | 568


153 Delete Node in a Linked List
Write a function to delete a node (except the tail) in a singly linked list, given only access to that node.
Supposed the linked list is 1 ->2 ->3 ->4 and you are given the third node with value 3, the linked list should
become 1 ->2 ->4 after calling your function.

153.1 Java Solution

public void deleteNode(ListNode node) {


[Link] = [Link];
[Link] = [Link];
}

296 | 568
154 Reverse Nodes in kGroup
Given a linked list, reverse the nodes of a linked list k at a time and return its modified list. If the number of
nodes is not a multiple of k then left-out nodes in the end should remain as it is. You may not alter the values in
the nodes, only nodes itself may be changed.
For example,

Given this linked list: 1->2->3->4->5


For k = 2, you should return: 2->1->4->3->5
For k = 3, you should return: 3->2->1->4->5

154.1 Java Solution

public ListNode reverseKGroup(ListNode head, int k) {


if(head==null||k==1)
return head;

ListNode fake = new ListNode(0);


[Link] = head;
ListNode prev = fake;
int i=0;

ListNode p = head;
while(p!=null){
i++;
if(i%k==0){
prev = reverse(prev, [Link]);
p = [Link];
}else{
p = [Link];
}
}

return [Link];
}

public ListNode reverse(ListNode prev, ListNode next){


ListNode last = [Link];
ListNode curr = [Link];

while(curr != next){
[Link] = [Link];
[Link] = [Link];
[Link] = curr;
curr = [Link];
}

return last;

297 | 568
154 Reverse Nodes in kGroup

We can write the reverse method differently like the following. I personally it is more understandable.

private ListNode reverse(ListNode prev, ListNode next){


ListNode p1 = [Link];
ListNode p2 = [Link];

while(p2 != next){
ListNode t = [Link];
[Link] = p1;
p1 = p2;
p2 = t;
}

ListNode rNode = [Link];

[Link] = next;
[Link] = p1;

return rNode;

Program Creek 298 | 568


154 Reverse Nodes in kGroup

Program Creek 299 | 568


155 Plus One Linked List
Given a non-negative number represented as a singly linked list of digits, plus one to the number.
The digits are stored such that the most significant digit is at the head of the list.
Example:

Input:
1->2->3

Output:
1->2->4

155.1 Java Solution

public ListNode plusOne(ListNode head) {


ListNode h2 = reverse(head);

ListNode p=h2;

while(p!=null){
if([Link]+1<=9){
[Link]=[Link]+1;
break;
}else{
[Link]=0;
if([Link]==null){
[Link] = new ListNode(1);
break;
}
p=[Link];
}
}

return reverse(h2);
}

public ListNode reverse(ListNode head){


if(head==null||[Link]==null)
return head;

ListNode p1=head;
ListNode p2=[Link];
while(p2!=null){
ListNode t = [Link];
[Link]=p1;
p1=p2;
p2=t;
}

300 | 568
155 Plus One Linked List

[Link]=null;

return p1;
}

Program Creek 301 | 568


156 Binary Tree Preorder Traversal
Preorder binary tree traversal is a classic interview problem. The key to solve this problem is using a stack to
store left and right children, and push right child first so that it is processed after the left child.

156.1 Java Solution

public class TreeNode {


int val;
TreeNode left;
TreeNode right;
TreeNode(int x) { val = x; }
}

public class Solution {


public ArrayList<Integer> preorderTraversal(TreeNode root) {
ArrayList<Integer> returnList = new ArrayList<Integer>();

if(root == null)
return returnList;

Stack<TreeNode> stack = new Stack<TreeNode>();


[Link](root);

while(![Link]()){
TreeNode n = [Link]();
[Link]([Link]);

if([Link] != null){
[Link]([Link]);
}
if([Link] != null){
[Link]([Link]);
}

}
return returnList;
}
}

302 | 568
157 Binary Tree Inorder Traversal
There are 3 solutions for solving this problem.

157.1 Java Solution 1 - Iterative


The key to solve inorder traversal of binary tree includes the following:
• The order of "inorder" is: left child ->parent ->right child
• Use a stack to track nodes

public List<Integer> inorderTraversal(TreeNode root) {


ArrayList<Integer> result = new ArrayList<>();
Stack<TreeNode> stack = new Stack<>();

TreeNode p = root;
while(p!=null){
[Link](p);
p=[Link];
}

while(![Link]()){
TreeNode t = [Link]();
[Link]([Link]);

t = [Link];
while(t!=null){
[Link](t);
t = [Link];
}
}

return result;
}

157.2 Java Solution 2 - Recursive


The recursive solution is trivial.

public class Solution {


List<Integer> result = new ArrayList<Integer>();

public List<Integer> inorderTraversal(TreeNode root) {


if(root !=null){
helper(root);
}

return result;
}

303 | 568
157 Binary Tree Inorder Traversal

public void helper(TreeNode p){


if([Link]!=null)
helper([Link]);

[Link]([Link]);

if([Link]!=null)
helper([Link]);
}
}

157.3 Java Solution 3 - Simple


The following solution is simple, but it changes the tree structure, i.e., remove pointers to left and right children.

public List<Integer> inorderTraversal(TreeNode root) {


List<Integer> result = new ArrayList<Integer>();
if(root==null)
return result;
Stack<TreeNode> stack = new Stack<TreeNode>();
[Link](root);

while(![Link]()){
TreeNode top = [Link]();
if([Link]!=null){
[Link]([Link]);
[Link]=null;
}else{
[Link]([Link]);
[Link]();
if([Link]!=null){
[Link]([Link]);
}
}
}

return result;
}

Program Creek 304 | 568


158 Binary Tree Postorder Traversal
Among preoder, inorder and postorder binary tree traversal problems, postorder traversal is the most complicated
one.

158.1 Java Solution 1


The key to to iterative postorder traversal is the following:

• The order of "Postorder" is: left child ->right child ->parent node.
• Find the relation between the previously visited node and the current node
• Use a stack to track nodes

As we go down the tree to the lft, check the previously visited node. If the current node is the left or right child
of the previous node, then keep going down the tree, and add left/right node to stack when applicable. When
there is no children for current node, i.e., the current node is a leaf, pop it from the stack. Then the previous node
become to be under the current node for next loop. You can using an example to walk through the code.

//Definition for binary tree


public class TreeNode {
int val;
TreeNode left;
TreeNode right;
TreeNode(int x) { val = x; }
}

public class Solution {


public ArrayList<Integer> postorderTraversal(TreeNode root) {

ArrayList<Integer> lst = new ArrayList<Integer>();

if(root == null)
return lst;

Stack<TreeNode> stack = new Stack<TreeNode>();


[Link](root);

TreeNode prev = null;


while(![Link]()){

305 | 568
158 Binary Tree Postorder Traversal

TreeNode curr = [Link]();

// go down the tree.


//check if current node is leaf, if so, process it and pop stack,
//otherwise, keep going down
if(prev == null || [Link] == curr || [Link] == curr){
//prev == null is the situation for the root node
if([Link] != null){
[Link]([Link]);
}else if([Link] != null){
[Link]([Link]);
}else{
[Link]();
[Link]([Link]);
}

//go up the tree from left node


//need to check if there is a right child
//if yes, push it to stack
//otherwise, process parent and pop stack
}else if([Link] == prev){
if([Link] != null){
[Link]([Link]);
}else{
[Link]();
[Link]([Link]);
}

//go up the tree from right node


//after coming back from right node, process parent node and pop stack.
}else if([Link] == prev){
[Link]();
[Link]([Link]);
}

prev = curr;
}

return lst;
}
}

158.2 Java Solution 2 - Simple!


This solution is simple, but note that the tree’s structure gets changed since children are set to null.

public List<Integer> postorderTraversal(TreeNode root) {


List<Integer> res = new ArrayList<Integer>();

if(root==null) {
return res;
}

Stack<TreeNode> stack = new Stack<TreeNode>();


[Link](root);

Program Creek 306 | 568


158 Binary Tree Postorder Traversal

while(![Link]()) {
TreeNode temp = [Link]();
if([Link]==null && [Link]==null) {
TreeNode pop = [Link]();
[Link]([Link]);
}
else {
if([Link]!=null) {
[Link]([Link]);
[Link] = null;
}

if([Link]!=null) {
[Link]([Link]);
[Link] = null;
}
}
}

return res;
}

Program Creek 307 | 568


159 Binary Tree Level Order Traversal
Given a binary tree, return the level order traversal of its nodes’ values. (ie, from left to right, level by level).
For example: Given binary tree 3,9,20,#,#,15,7,

3
/ \
9 20
/ \
15 7

return its level order traversal as [[3], [9,20], [15,7]]

159.1 Java Solution 1


It is obvious that this problem can be solve by using a queue. However, if we use one queue we can not track
when each level starts. So we use two queues to track the current level and the next level.

public ArrayList<ArrayList<Integer>> levelOrder(TreeNode root) {


ArrayList<ArrayList<Integer>> al = new ArrayList<ArrayList<Integer>>();
ArrayList<Integer> nodeValues = new ArrayList<Integer>();
if(root == null)
return al;

LinkedList<TreeNode> current = new LinkedList<TreeNode>();


LinkedList<TreeNode> next = new LinkedList<TreeNode>();
[Link](root);

while(![Link]()){
TreeNode node = [Link]();

if([Link] != null)
[Link]([Link]);
if([Link] != null)
[Link]([Link]);

[Link]([Link]);
if([Link]()){
current = next;
next = new LinkedList<TreeNode>();
[Link](nodeValues);
nodeValues = new ArrayList();
}

}
return al;
}

308 | 568
159 Binary Tree Level Order Traversal

159.2 Java Solution 2


We can also improve Solution 1 by use a queue of integer to track the level instead of track another level of nodes.

public List<List<Integer>> levelOrder(TreeNode root) {


List<List<Integer>> result = new ArrayList<>();

if(root==null){
return result;
}

LinkedList<TreeNode> nodeQueue = new LinkedList<>();


LinkedList<Integer> levelQueue = new LinkedList<>();

[Link](root);
[Link](1);//start from 1

while(![Link]()){
TreeNode node = [Link]();
int level = [Link]();

List<Integer> l=null;
if([Link]()<level){
l = new ArrayList<>();
[Link](l);
}else{
l = [Link](level-1);
}

[Link]([Link]);

if([Link]!=null){
[Link]([Link]);
[Link](level+1);
}

if([Link]!=null){
[Link]([Link]);
[Link](level+1);
}
}

return result;
}

Program Creek 309 | 568


160 Binary Tree Level Order Traversal II
Given a binary tree, return the bottom-up level order traversal of its nodes’ values.
For example, given binary tree 3,9,20,#,#,15,7,

3
/ \
9 20
/ \
15 7

return its level order traversal as [[15,7], [9,20],[3]]

160.1 Java Solution

public List<ArrayList<Integer>> levelOrderBottom(TreeNode root) {


ArrayList<ArrayList<Integer>> result = new ArrayList<ArrayList<Integer>>();

if(root == null){
return result;
}

LinkedList<TreeNode> current = new LinkedList<TreeNode>();


LinkedList<TreeNode> next = new LinkedList<TreeNode>();
[Link](root);

ArrayList<Integer> numberList = new ArrayList<Integer>();

// need to track when each level starts


while(![Link]()){
TreeNode head = [Link]();

[Link]([Link]);

if([Link] != null){
[Link]([Link]);
}
if([Link]!= null){
[Link]([Link]);
}

if([Link]()){
current = next;
next = new LinkedList<TreeNode>();
[Link](numberList);
numberList = new ArrayList<Integer>();
}
}

//return [Link](result);

310 | 568
160 Binary Tree Level Order Traversal II

ArrayList<ArrayList<Integer>> reversedResult = new ArrayList<ArrayList<Integer>>();


for(int i=[Link]()-1; i>=0; i--){
[Link]([Link](i));
}

return reversedResult;
}

Program Creek 311 | 568


161 Binary Tree Vertical Order Traversal
Given a binary tree, return the vertical order traversal of its nodes’ values. (ie, from top to bottom, column by
column).

161.1 Java Solution


For each node, its left child’s degree is -1 and is right child’s degree is +1. We can do a level order traversal and
save the degree information.

public List<List<Integer>> verticalOrder(TreeNode root) {


TreeMap<Integer, ArrayList<Integer>> map = new TreeMap<>();
helper(root, map);
List<List<Integer>> result = new ArrayList<>();
[Link]([Link]());
return result;
}

private void helper(TreeNode t, TreeMap<Integer, ArrayList<Integer>> map) {


if (t == null) {
return;
}

LinkedList<TreeNode> q1 = new LinkedList<>();


LinkedList<Integer> q2 = new LinkedList<>();
[Link](t);
[Link](0);

while (![Link]()) {
TreeNode node = [Link]();
int order = [Link]();

//add to map
ArrayList<Integer> list = [Link](order);
if (list == null) {
list = new ArrayList<>();
[Link](order, list);
}
[Link]([Link]);

if ([Link] != null) {
[Link]([Link]);
[Link](order - 1);
}

if ([Link] != null) {
[Link]([Link]);
[Link](order + 1);
}
}
}

312 | 568
161 Binary Tree Vertical Order Traversal

Time complexity is O(n*log(n)) and space complexity is O(n). n is the number of nodes on the tree.

Program Creek 313 | 568


162 Invert Binary Tree

162.1 Java Solution 1 - Recursive

public TreeNode invertTree(TreeNode root) {


helper(root);
return root;
}

public void helper(TreeNode n){


if(n==null){
return;
}

TreeNode t = [Link];
[Link] = [Link];
[Link] = t;

helper([Link]);
helper([Link]);
}

162.2 Java Solution 2 - Iterative

public TreeNode invertTree(TreeNode root) {


LinkedList<TreeNode> queue = new LinkedList<TreeNode>();

if(root!=null){
[Link](root);
}

while(![Link]()){
TreeNode p = [Link]();
if([Link]!=null)
[Link]([Link]);
if([Link]!=null)
[Link]([Link]);

TreeNode temp = [Link];


[Link] = [Link];
[Link] = temp;
}

return root;
}

314 | 568
163 Kth Smallest Element in a BST
Given a binary search tree, write a function kthSmallest to find the kth smallest element in it. (1 ≤ k ≤ BST’s total
elements)

163.1 Java Solution 1 - Inorder Traversal


We can inorder traverse the tree and get the kth smallest element. Time is O(n).

public int kthSmallest(TreeNode root, int k) {


Stack<TreeNode> stack = new Stack<TreeNode>();

TreeNode p = root;
int result = 0;

while(![Link]() || p!=null){
if(p!=null){
[Link](p);
p = [Link];
}else{
TreeNode t = [Link]();
k--;
if(k==0)
result = [Link];
p = [Link];
}
}

return result;
}

Similarly, we can also write the inorder traversal as the following:

public int kthSmallest(TreeNode root, int k) {


Stack<TreeNode> stack = new Stack<TreeNode>();
TreeNode p = root;
while(p!=null){
[Link](p);
p=[Link];
}
int i=0;
while(![Link]()){
TreeNode t = [Link]();
i++;

if(i==k)
return [Link];

TreeNode r = [Link];
while(r!=null){
[Link](r);

315 | 568
163 Kth Smallest Element in a BST

r=[Link];
}

return -1;
}

163.2 Java Solution 2 - Extra Data Structure


We can let each node track the order, i.e., the number of elements that are less than itself. Time is O(log(n)).

Program Creek 316 | 568


164 Binary Tree Longest Consecutive Sequence
Given a binary tree, find the length of the longest consecutive sequence path.
The path refers to any sequence of nodes from some starting node to any node in the tree along the parent-child
connections. The longest consecutive path need to be from parent to child (cannot be the reverse).

164.1 Java Solution 1 - BFS

public int longestConsecutive(TreeNode root) {


if(root==null)
return 0;

LinkedList<TreeNode> nodeQueue = new LinkedList<TreeNode>();


LinkedList<Integer> sizeQueue = new LinkedList<Integer>();

[Link](root);
[Link](1);
int max=1;

while(![Link]()){
TreeNode head = [Link]();
int size = [Link]();

if([Link]!=null){
int leftSize=size;
if([Link]==[Link]-1){
leftSize++;
max = [Link](max, leftSize);
}else{
leftSize=1;
}

[Link]([Link]);
[Link](leftSize);
}

if([Link]!=null){
int rightSize=size;
if([Link]==[Link]-1){
rightSize++;
max = [Link](max, rightSize);
}else{
rightSize=1;
}

[Link]([Link]);
[Link](rightSize);
}

317 | 568
164 Binary Tree Longest Consecutive Sequence

return max;
}

164.2 Java Solution 2 - DFS

class Solution {
int max;

public int longestConsecutive(TreeNode root) {


helper(root);
return max;
}

private int helper(TreeNode t){


if(t==null){
return 0;
}

int leftMax = helper([Link]);


int rightMax = helper([Link]);

int leftTotal = 0;
if([Link] == null){
leftTotal = 1;
}else if([Link]+1 == [Link]){
leftTotal = leftMax+1;
}else{
leftTotal = 1;
}

int rightTotal = 0;
if([Link] == null){
rightTotal = 1;
}else if([Link]+1 == [Link]){
rightTotal = rightMax+1;
}else{
rightTotal = 1;
}

max = [Link](max, leftTotal);


max = [Link](max, rightTotal);

int longer = [Link](leftTotal, rightTotal);

return longer;
}
}

Program Creek 318 | 568


165 Validate Binary Search Tree
Given a binary tree, determine if it is a valid binary search tree (BST).
Assume a BST is defined as follows:

• The left subtree of a node contains only nodes with keys less than the node’s key.
• The right subtree of a node contains only nodes with keys greater than the node’s key.
• Both the left and right subtrees must also be binary search trees.

165.1 Java Solution 1 - Recursive


All values on the left sub tree must be less than parent and parent’s parent, and all values on the right sub tree
must be greater than parent and parent’s parent. So we just check the boundaries for each node.

public boolean isValidBST(TreeNode root) {


return isValidBST(root, Double.NEGATIVE_INFINITY, Double.POSITIVE_INFINITY);
}

public boolean isValidBST(TreeNode p, double min, double max){


if(p==null)
return true;

if([Link] <= min || [Link] >= max)


return false;

return isValidBST([Link], min, [Link]) && isValidBST([Link], [Link], max);


}

This solution also goes to the left subtree first. If the violation occurs close to the root but on the right subtree,
the method still cost time O(n) and space O(h).
The following solution can handle violations close to root node faster.

public boolean isValidBST(TreeNode root) {


return helper(root, Double.NEGATIVE_INFINITY, Double.POSITIVE_INFINITY);
}

public boolean helper(TreeNode root, double min, double max){


if(root==null){
return true;
}

if([Link]<=min||[Link]>=max){
return false;
}

boolean isLeftBST = helper([Link], min, [Link]);


boolean isRightBST = helper([Link], [Link], max);

if(!isLeftBST||!isRightBST){
return false;

319 | 568
165 Validate Binary Search Tree

return true;
}

165.2 Java Solution 2 - Iterative

public class Solution {


public boolean isValidBST(TreeNode root) {
if(root == null)
return true;

LinkedList<BNode> queue = new LinkedList<BNode>();


[Link](new BNode(root, Double.NEGATIVE_INFINITY, Double.POSITIVE_INFINITY));
while(![Link]()){
BNode b = [Link]();
if([Link] <= [Link] || [Link] >=[Link]){
return false;
}
if([Link]!=null){
[Link](new BNode([Link], [Link], [Link]));
}
if([Link]!=null){
[Link](new BNode([Link], [Link], [Link]));
}
}
return true;
}
}
//define a BNode class with TreeNode and it’s boundaries
class BNode{
TreeNode n;
double left;
double right;
public BNode(TreeNode n, double left, double right){
this.n = n;
[Link] = left;
[Link] = right;
}
}

Time and space are both O(n).

165.3 Java Solution 3 - In-order traversal


Since inorder traversal of BST is ascending, so we can check the sequence. Time is O(n) and space is O(h). h is
the height of the stack which is the tree’s height.

Program Creek 320 | 568


166 Flatten Binary Tree to Linked List
Given a binary tree, flatten it to a linked list in-place.
For example, Given

1
/ \
2 5
/ \ \
3 4 6

The flattened tree should look like:

1
\
2
\
3
\
4
\
5
\
6

166.1 Java Solution


Go down the tree to the left, when the right child is not null, push the right child to the stack.

/**
* Definition for binary tree
* public class TreeNode {
* int val;
* TreeNode left;
* TreeNode right;
* TreeNode(int x) { val = x; }
* }
*/
public class Solution {
public void flatten(TreeNode root) {
Stack<TreeNode> stack = new Stack<TreeNode>();
TreeNode p = root;

while(p != null || ![Link]()){

if([Link] != null){
[Link]([Link]);
}

if([Link] != null){

321 | 568
166 Flatten Binary Tree to Linked List

[Link] = [Link];
[Link] = null;
}else if(![Link]()){
TreeNode temp = [Link]();
[Link]=temp;
}

p = [Link];
}
}
}

Program Creek 322 | 568


167 Path Sum
Given a binary tree and a sum, determine if the tree has a root-to-leaf path such that adding up all the values
along the path equals the given sum.
For example: Given the below binary tree and sum = 22,

5
/ \
4 8
/ / \
11 13 4
/ \ \
7 2 1

return true, as there exist a root-to-leaf path 5->4->11->2 which sum is 22.

167.1 Java Solution 1 - Using Queue


Add all node to a queue and store sum value of each node to another queue. When it is a leaf node, check the
stored sum value.
For the tree above, the queue would be: 5 - 4 - 8 - 11 - 13 - 4 - 7 - 2 - 1. It will check node 13, 7, 2 and 1. This is
a typical breadth first search(BFS) problem.

/**
* Definition for binary tree
* public class TreeNode {
* int val;
* TreeNode left;
* TreeNode right;
* TreeNode(int x) { val = x; }
* }
*/
public class Solution {
public boolean hasPathSum(TreeNode root, int sum) {
if(root == null) return false;

LinkedList<TreeNode> nodes = new LinkedList<TreeNode>();


LinkedList<Integer> values = new LinkedList<Integer>();

[Link](root);
[Link]([Link]);

while(![Link]()){
TreeNode curr = [Link]();
int sumValue = [Link]();

if([Link] == null && [Link] == null && sumValue==sum){


return true;
}

if([Link] != null){

323 | 568
167 Path Sum

[Link]([Link]);
[Link](sumValue+[Link]);
}

if([Link] != null){
[Link]([Link]);
[Link](sumValue+[Link]);
}
}

return false;
}
}

167.2 Java Solution 2 - Recursion

public boolean hasPathSum(TreeNode root, int sum) {


if (root == null)
return false;
if ([Link] == sum && ([Link] == null && [Link] == null))
return true;

return hasPathSum([Link], sum - [Link])


|| hasPathSum([Link], sum - [Link]);
}

Thanks to nebulaliang, this solution is wonderful!

Program Creek 324 | 568


168 Path Sum II
Given a binary tree and a sum, find all root-to-leaf paths where each path’s sum equals the given sum.
For example, given the below binary tree and sum = 22,

5
/ \
4 8
/ / \
11 13 4
/ \ / \
7 2 5 1

the method returns the following:

[
[5,4,11,2],
[5,8,4,5]
]

168.1 Analysis
This problem can be converted to be a typical depth-first search problem. A recursive depth-first search algorithm
usually requires a recursive method call, a reference to the final result, a temporary result, etc.

168.2 Java Solution

public List<ArrayList<Integer>> pathSum(TreeNode root, int sum) {


ArrayList<ArrayList<Integer>> result = new ArrayList<ArrayList<Integer>>();
if(root == null)
return result;

ArrayList<Integer> l = new ArrayList<Integer>();


[Link]([Link]);
dfs(root, [Link], result, l);
return result;
}

public void dfs(TreeNode t, int sum, ArrayList<ArrayList<Integer>> result, ArrayList<Integer> l){


if([Link]==null && [Link]==null && sum==0){
ArrayList<Integer> temp = new ArrayList<Integer>();
[Link](l);
[Link](temp);
}

//search path of left node


if([Link] != null){
[Link]([Link]);

325 | 568
168 Path Sum II

dfs([Link], [Link], result, l);


[Link]([Link]()-1);
}

//search path of right node


if([Link]!=null){
[Link]([Link]);
dfs([Link], [Link], result, l);
[Link]([Link]()-1);
}
}

Program Creek 326 | 568


169 Construct Binary Tree from Inorder and
Postorder Traversal
Given inorder and postorder traversal of a tree, construct the binary tree.

169.1 Analysis
This problem can be illustrated by using a simple example.

in-order: 4 2 5 (1) 6 7 3 8
post-order: 4 5 2 6 7 8 3 (1)

From the post-order array, we know that last element is the root. We can find the root in in-order array. Then
we can identify the left and right sub-trees of the root from in-order array.
Using the length of left sub-tree, we can identify left and right sub-trees in post-order array. Recursively, we
can build up the tree.

169.2 Java Solution

public TreeNode buildTree(int[] inorder, int[] postorder) {


int inStart = 0;
int inEnd = [Link] - 1;
int postStart = 0;
int postEnd = [Link] - 1;

return buildTree(inorder, inStart, inEnd, postorder, postStart, postEnd);


}

public TreeNode buildTree(int[] inorder, int inStart, int inEnd,


int[] postorder, int postStart, int postEnd) {
if (inStart > inEnd || postStart > postEnd)
return null;

int rootValue = postorder[postEnd];


TreeNode root = new TreeNode(rootValue);

327 | 568
169 Construct Binary Tree from Inorder and Postorder Traversal

int k = 0;
for (int i = 0; i < [Link]; i++) {
if (inorder[i] == rootValue) {
k = i;
break;
}
}

[Link] = buildTree(inorder, inStart, k - 1, postorder, postStart,


postStart + k - (inStart + 1));
// Becuase k is not the length, it it need to -(inStart+1) to get the length
[Link] = buildTree(inorder, k + 1, inEnd, postorder, postStart + k- inStart, postEnd - 1);
// postStart+k-inStart = postStart+k-(inStart+1) +1

return root;
}

Program Creek 328 | 568


170 Construct Binary Tree from Preorder and
Inorder Traversal
Given preorder and inorder traversal of a tree, construct the binary tree.

170.1 Analysis
Consider the following example:

in-order: 4 2 5 (1) 6 7 3 8
pre-order: (1) 2 4 5 3 7 6 8

From the pre-order array, we know that first element is the root. We can find the root in in-order array. Then
we can identify the left and right sub-trees of the root from in-order array.
Using the length of left sub-tree, we can identify left and right sub-trees in pre-order array. Recursively, we can
build up the tree.

170.2 Java Solution

public TreeNode buildTree(int[] preorder, int[] inorder) {


int preStart = 0;
int preEnd = [Link]-1;
int inStart = 0;
int inEnd = [Link]-1;

return construct(preorder, preStart, preEnd, inorder, inStart, inEnd);


}

public TreeNode construct(int[] preorder, int preStart, int preEnd, int[] inorder, int inStart, int
inEnd){
if(preStart>preEnd||inStart>inEnd){
return null;
}

int val = preorder[preStart];


TreeNode p = new TreeNode(val);

329 | 568
170 Construct Binary Tree from Preorder and Inorder Traversal

//find parent element index from inorder


int k=0;
for(int i=0; i<[Link]; i++){
if(val == inorder[i]){
k=i;
break;
}
}

[Link] = construct(preorder, preStart+1, preStart+(k-inStart), inorder, inStart, k-1);


[Link]= construct(preorder, preStart+(k-inStart)+1, preEnd, inorder, k+1 , inEnd);

return p;
}

Program Creek 330 | 568


171 Convert Sorted Array to Binary Search Tree
Given an array where elements are sorted in ascending order, convert it to a height balanced BST.

171.1 Java Solution


A typical DFS problem using recursion.

// Definition for binary tree


class TreeNode {
int val;
TreeNode left;
TreeNode right;

TreeNode(int x) {
val = x;
}
}

public class Solution {


public TreeNode sortedArrayToBST(int[] num) {
if ([Link] == 0)
return null;

return sortedArrayToBST(num, 0, [Link] - 1);


}

public TreeNode sortedArrayToBST(int[] num, int start, int end) {


if (start > end)
return null;

int mid = (start + end) / 2;


TreeNode root = new TreeNode(num[mid]);
[Link] = sortedArrayToBST(num, start, mid - 1);
[Link] = sortedArrayToBST(num, mid + 1, end);

return root;
}
}

331 | 568
172 Convert Sorted List to Binary Search Tree
Given a singly linked list where elements are sorted in ascending order, convert it to a height balanced BST.

172.1 Thoughts
If you are given an array, the problem is quite straightforward. But things get a little more complicated when you
have a singly linked list instead of an array. Now you no longer have random access to an element in O(1) time.
Therefore, you need to create nodes bottom-up, and assign them to its parents. The bottom-up approach enables
us to access the list in its order at the same time as creating nodes.

172.2 Java Solution

// Definition for singly-linked list.


class ListNode {
int val;
ListNode next;

ListNode(int x) {
val = x;
next = null;
}
}

// Definition for binary tree


class TreeNode {
int val;
TreeNode left;
TreeNode right;

TreeNode(int x) {
val = x;
}
}

public class Solution {


static ListNode h;

public TreeNode sortedListToBST(ListNode head) {


if (head == null)
return null;

h = head;
int len = getLength(head);
return sortedListToBST(0, len - 1);
}

// get list length


public int getLength(ListNode head) {

332 | 568
172 Convert Sorted List to Binary Search Tree

int len = 0;
ListNode p = head;

while (p != null) {
len++;
p = [Link];
}
return len;
}

// build tree bottom-up


public TreeNode sortedListToBST(int start, int end) {
if (start > end)
return null;

// mid
int mid = (start + end) / 2;

TreeNode left = sortedListToBST(start, mid - 1);


TreeNode root = new TreeNode([Link]);
h = [Link];
TreeNode right = sortedListToBST(mid + 1, end);

[Link] = left;
[Link] = right;

return root;
}
}

Program Creek 333 | 568


173 Minimum Depth of Binary Tree
Given a binary tree, find its minimum depth.
The minimum depth is the number of nodes along the shortest path from the root node down to the nearest
leaf node.

173.1 Thoughts
LinkedList is a queue in Java. The add() and remove() methods are used to manipulate the queue.

173.2 Java Solution

/**
* Definition for binary tree
* public class TreeNode {
* int val;
* TreeNode left;
* TreeNode right;
* TreeNode(int x) { val = x; }
* }
*/
public class Solution {
public int minDepth(TreeNode root) {
if(root == null){
return 0;
}

LinkedList<TreeNode> nodes = new LinkedList<TreeNode>();


LinkedList<Integer> counts = new LinkedList<Integer>();

[Link](root);
[Link](1);

while(![Link]()){
TreeNode curr = [Link]();
int count = [Link]();

if([Link] == null && [Link] == null){


return count;
}

if([Link] != null){
[Link]([Link]);
[Link](count+1);
}

if([Link] != null){
[Link]([Link]);
[Link](count+1);

334 | 568
173 Minimum Depth of Binary Tree

}
}

return 0;
}
}

Program Creek 335 | 568


174 Binary Tree Maximum Path Sum
Given a binary tree, find the maximum path sum. The path may start and end at any node in the tree. For
example, given the below binary tree

1
/ \
2 3

the result is 6.

174.1 Analysis
1) Recursively solve this problem 2) Get largest left sum and right sum 2) Compare to the stored maximum

174.2 Java Solution


We can also use an array to store value for recursive methods.

public int maxPathSum(TreeNode root) {


int max[] = new int[1];
max[0] = Integer.MIN_VALUE;
calculateSum(root, max);
return max[0];
}

public int calculateSum(TreeNode root, int[] max) {


if (root == null)
return 0;

int left = calculateSum([Link], max);


int right = calculateSum([Link], max);

int current = [Link]([Link], [Link]([Link] + left, [Link] + right));

max[0] = [Link](max[0], [Link](current, left + [Link] + right));

return current;
}

336 | 568
175 Balanced Binary Tree
Given a binary tree, determine if it is height-balanced.
For this problem, a height-balanced binary tree is defined as a binary tree in which the depth of the two subtrees
of every node never differ by more than 1.

175.1 Analysis
This is a typical tree problem that can be solve by using recursion.

175.2 Java Solution

// Definition for binary tree


class TreeNode {
int val;
TreeNode left;
TreeNode right;

TreeNode(int x) {
val = x;
}
}

public class Solution {


public boolean isBalanced(TreeNode root) {
if (root == null)
return true;

if (getHeight(root) == -1)
return false;

return true;
}

public int getHeight(TreeNode root) {


if (root == null)
return 0;

int left = getHeight([Link]);


int right = getHeight([Link]);

if (left == -1 || right == -1)


return -1;

if ([Link](left - right) > 1) {


return -1;
}

return [Link](left, right) + 1;

337 | 568
175 Balanced Binary Tree

}
}

Program Creek 338 | 568


176 Symmetric Tree

176.1 Problem
Given a binary tree, check whether it is a mirror of itself (ie, symmetric around its center).
For example, this binary tree is symmetric:

1
/ \
2 2
/ \ / \
3 4 4 3

But the following is not:

1
/ \
2 2
\ \
3 3

176.2 Java Solution - Recursion


This problem can be solve by using a simple recursion. The key is finding the conditions that return false, such
as value is not equal, only one node(left or right) has value.

public boolean isSymmetric(TreeNode root) {


if (root == null)
return true;
return isSymmetric([Link], [Link]);
}

public boolean isSymmetric(TreeNode l, TreeNode r) {


if (l == null && r == null) {
return true;
} else if (r == null || l == null) {
return false;
}

if ([Link] != [Link])
return false;

if (!isSymmetric([Link], [Link]))
return false;
if (!isSymmetric([Link], [Link]))
return false;

return true;
}

339 | 568
177 Binary Search Tree Iterator

177.1 Problem
Implement an iterator over a binary search tree (BST). Your iterator will be initialized with the root node of a BST.
Calling next() will return the next smallest number in the BST. Note: next() and hasNext() should run in average
O(1) time and uses O(h) memory, where h is the height of the tree.

177.2 Java Solution


The key to solve this problem is understanding the features of BST. Here is an example BST.

/**
* Definition for binary tree
* public class TreeNode {
* int val;
* TreeNode left;
* TreeNode right;
* TreeNode(int x) { val = x; }
* }
*/

public class BSTIterator {


Stack<TreeNode> stack;

public BSTIterator(TreeNode root) {


stack = new Stack<TreeNode>();
while (root != null) {
[Link](root);
root = [Link];

340 | 568
177 Binary Search Tree Iterator

}
}

public boolean hasNext() {


return ![Link]();
}

public int next() {


TreeNode node = [Link]();
int result = [Link];
if ([Link] != null) {
node = [Link];
while (node != null) {
[Link](node);
node = [Link];
}
}
return result;
}
}

Program Creek 341 | 568


178 Binary Tree Right Side View
Given a binary tree, imagine yourself standing on the right side of it, return the values of the nodes you can see
ordered from top to bottom. For example, given the following binary tree,

1 <---
/ \
2 3 <---
\
5 <---

You can see [1, 3, 5].

178.1 Analysis
This problem can be solve by using a queue. On each level of the tree, we add the right-most element to the
results.

178.2 Java Solution

public List<Integer> rightSideView(TreeNode root) {


ArrayList<Integer> result = new ArrayList<Integer>();

if(root == null) return result;

LinkedList<TreeNode> queue = new LinkedList<TreeNode>();


[Link](root);

while([Link]() > 0){


//get size here
int size = [Link]();

for(int i=0; i<size; i++){


TreeNode top = [Link]();

//the first element in the queue (right-most of the tree)


if(i==0){
[Link]([Link]);
}
//add right first
if([Link] != null){
[Link]([Link]);
}
//add left
if([Link] != null){
[Link]([Link]);
}
}
}

342 | 568
178 Binary Tree Right Side View

return result;
}

Similarly, we can also use two queues which makes the code slightly more readable.

public List<Integer> rightSideView(TreeNode root) {


LinkedList<TreeNode> q1 = new LinkedList<>();
LinkedList<Integer> q2 = new LinkedList<>();

ArrayList<Integer> result = new ArrayList<>();


if (root == null) {
return result;
}

[Link](root);
[Link](1);
int prev = 0;

while (![Link]()) {
TreeNode h = [Link]();
int level = [Link]();

if (level != prev) {
[Link]([Link]);
}

if ([Link] != null) {
[Link]([Link]);
[Link](level + 1);
}

if ([Link] != null) {
[Link]([Link]);
[Link](level + 1);
}

prev = level;
}

return result;
}

Program Creek 343 | 568


179 Lowest Common Ancestor of a Binary Search
Tree
Given a binary search tree (BST), find the lowest common ancestor (LCA) of two given nodes in the BST.

179.1 Analysis
This problem can be solved by using BST property, i.e., left <parent <right for each node. There are 3 cases to
handle.

179.2 Java Solution 1 - Recursive

public TreeNode lowestCommonAncestor(TreeNode root, TreeNode p, TreeNode q) {


TreeNode m = root;

if([Link] > [Link] && [Link] < [Link]){


return m;
}else if([Link]>[Link] && [Link] > [Link]){
return lowestCommonAncestor([Link], p, q);
}else if([Link]<[Link] && [Link] < [Link]){
return lowestCommonAncestor([Link], p, q);
}

return root;
}

179.3 Java Solution 2 - Iterative

public TreeNode lowestCommonAncestor(TreeNode root, TreeNode p, TreeNode q) {


TreeNode t = root;

while(t!=null){
if([Link] >[Link] && [Link] >[Link]){
t = [Link];
}else if ([Link]<[Link] && [Link]<[Link]){
t = [Link];
}else{
return t;
}
}

return null;
}

344 | 568
180 Lowest Common Ancestor of a Binary Tree
Given a binary tree, find the lowest common ancestor (LCA) of two given nodes in the tree.

180.1 Java Solution 1

public TreeNode lowestCommonAncestor(TreeNode root, TreeNode p, TreeNode q) {


if(root==null)
return null;

if(root==p || root==q)
return root;

TreeNode l = lowestCommonAncestor([Link], p, q);


TreeNode r = lowestCommonAncestor([Link], p, q);

if(l!=null&&r!=null){
return root;
}else if(l==null&&r==null){
return null;
}else{
return l==null?r:l;
}
}

To calculate time complexity, we know that f(n)=2*f(n-1)=2*2*f(n-2)=2ˆ(logn), so time=O(n).

180.2 Java Solution 2

class Solution {
public TreeNode lowestCommonAncestor(TreeNode root, TreeNode p, TreeNode q) {
CounterNode n = helper(root, p, q);
return [Link];
}

public CounterNode helper(TreeNode root, TreeNode p, TreeNode q){


if(root==null){
return new CounterNode(null, 0);
}

CounterNode left = helper([Link], p, q);


if([Link]==2){
return left;
}

CounterNode right = helper([Link], p, q);


if([Link]==2){
return right;

345 | 568
180 Lowest Common Ancestor of a Binary Tree

int c=[Link]+[Link]+(root==p?1:0)+(root==q?1:0);

return new CounterNode(root, c);

}
}

class CounterNode{
public int count;
public TreeNode node;

public CounterNode(TreeNode node, int count){


[Link]=count;
[Link]=node;
}
}

Program Creek 346 | 568


181 Most Frequent Subtree Sum
Given the root of a tree, you are asked to find the most frequent subtree sum. The subtree sum of a node is
defined as the sum of all the node values formed by the subtree rooted at that node (including the node itself).
So what is the most frequent subtree sum value? If there is a tie, return all the values with the highest frequency
in any order.
Examples 1 Input:
5 / 2 -3
return [2, -3, 4], since all the values happen only once, return all of them in any order.
Examples 2 Input:
5 / 2 -5
return [2], since 2 happens twice, however -5 only occur once.

181.1 Java Solution


We can solve this problem using a typical recursion on the tree, similar to LCA.

public int[] findFrequentTreeSum(TreeNode root) {


HashMap<Integer,Integer> map = new HashMap<>();

helper(root, map);

int maxCount = 0;
for(int i: [Link]()){
if([Link](i)>maxCount){
maxCount=[Link](i);
}
}

List<Integer> mf = new ArrayList<>();


for([Link]<Integer, Integer> entry: [Link]()){
if([Link]()==maxCount){
[Link]([Link]());
}
}

int[] result = new int[[Link]()];


int k=0;
for(int i: mf){
result[k++]=i;
}

return result;
}

public Integer helper(TreeNode root, HashMap<Integer,Integer> map){


if(root==null){
return null;
}

347 | 568
181 Most Frequent Subtree Sum

Integer left = helper([Link], map);


if(left==null){
left=0;
}

Integer right = helper([Link], map);


if(right==null){
right=0;
}

int sum = [Link] + left + right;


[Link](sum, [Link](sum, 0)+1);

return sum;
}

Program Creek 348 | 568


182 Verify Preorder Serialization of a Binary Tree
One way to serialize a binary tree is to use pre-order traversal. When we encounter a non-null node, we record
the node’s value. If it is a null node, we record using a sentinel value such as #.

9
/ \
3 2
/ \ / \
4 1 # 6
/ \ / \ / \
# # # # # #

For example, the above binary tree can be serialized to the string "9,3,4,#,#,1,#,#,2,#,6,#,#", where # represents a
null node.
Given a string of comma separated values, verify whether it is a correct preorder traversal serialization of a
binary tree. Find an algorithm without reconstructing the tree.

182.1 Java Solution


We can keep trimming the leaves until there is no one to remove. If a sequence is like "4 # #", change it to "#" and
continue. A stack is a good date structure for this purpose.

public boolean isValidSerialization(String preorder) {


LinkedList<String> stack = new LinkedList<String>();
String[] arr = [Link](",");

for(int i=0; i<[Link]; i++){


[Link](arr[i]);

while([Link]()>=3

349 | 568
182 Verify Preorder Serialization of a Binary Tree

&& [Link]([Link]()-1).equals("#")
&& [Link]([Link]()-2).equals("#")
&& ![Link]([Link]()-3).equals("#")){

[Link]([Link]()-1);
[Link]([Link]()-1);
[Link]([Link]()-1);

[Link]("#");
}

if([Link]()==1 && [Link](0).equals("#"))


return true;
else
return false;
}

If only stack operations are allowed, the solution can be written in the following way:

public boolean isValidSerialization(String preorder) {


String[] arr = [Link](",");

Stack<String> stack = new Stack<>();


for(String s: arr){
if([Link]() || ![Link]("#")){
[Link](s);
}else{
while(![Link]() && [Link]().equals("#")){
[Link]();
if([Link]()){
return false;
}else{
[Link]();
}
}
[Link]("#");
}
}

return [Link]()==1 && [Link]().equals("#");


}

Program Creek 350 | 568


183 Populating Next Right Pointers in Each Node
Given the following perfect binary tree,

1
/ \
2 3
/ \ / \
4 5 6 7

After calling your function, the tree should look like:

1 -> NULL
/ \
2 -> 3 -> NULL
/ \ / \
4->5->6->7 -> NULL

183.1 Java Solution 1 - Simple

public void connect(TreeLinkNode root) {


if(root==null)
return;

LinkedList<TreeLinkNode> nodeQueue = new LinkedList<TreeLinkNode>();


LinkedList<Integer> depthQueue = new LinkedList<Integer>();

if(root!=null){
[Link](root);
[Link](1);
}

while(![Link]()){
TreeLinkNode topNode = [Link]();
int depth = [Link]();

if([Link]()){
[Link] = null;
}else if([Link]()>depth){
[Link] = null;
}else{
[Link] = [Link]();
}

if([Link]!=null){
[Link]([Link]);
[Link](depth+1);
}

if([Link]!=null){

351 | 568
183 Populating Next Right Pointers in Each Node

[Link]([Link]);
[Link](depth+1);
}
}
}

183.2 Java Solution 2


This solution is easier to understand. You can use the example tree above to walk through the algorithm. The
basic idea is have 4 pointers to move towards right on two levels (see comments in the code).

public void connect(TreeLinkNode root) {


if(root == null)
return;

TreeLinkNode lastHead = root;//prevous level’s head


TreeLinkNode lastCurrent = null;//previous level’s pointer
TreeLinkNode currentHead = null;//currnet level’s head
TreeLinkNode current = null;//current level’s pointer

while(lastHead!=null){
lastCurrent = lastHead;

while(lastCurrent!=null){
if(currentHead == null){
currentHead = [Link];
current = [Link];
}else{
[Link] = [Link];
current = [Link];
}

if(currentHead != null){
[Link] = [Link];
current = [Link];
}

Program Creek 352 | 568


183 Populating Next Right Pointers in Each Node

lastCurrent = [Link];
}

//update last head


lastHead = currentHead;
currentHead = null;
}

Program Creek 353 | 568


184 Populating Next Right Pointers in Each Node
II
Follow up for problem "Populating Next Right Pointers in Each Node".
What if the given tree could be any binary tree? Would your previous solution still work?

184.1 Analysis
Similar to Populating Next Right Pointers in Each Node, we have 4 pointers at 2 levels of the tree.

184.2 Java Solution

public void connect(TreeLinkNode root) {


if(root == null)
return;

TreeLinkNode lastHead = root;//prevous level’s head


TreeLinkNode lastCurrent = null;//previous level’s pointer
TreeLinkNode currentHead = null;//currnet level’s head
TreeLinkNode current = null;//current level’s pointer

while(lastHead!=null){
lastCurrent = lastHead;

while(lastCurrent!=null){
//left child is not null
if([Link]!=null) {
if(currentHead == null){
currentHead = [Link];
current = [Link];
}else{
[Link] = [Link];
current = [Link];

354 | 568
184 Populating Next Right Pointers in Each Node II

}
}

//right child is not null


if([Link]!=null){
if(currentHead == null){
currentHead = [Link];
current = [Link];
}else{
[Link] = [Link];
current = [Link];
}
}

lastCurrent = [Link];
}

//update last head


lastHead = currentHead;
currentHead = null;
}
}

Program Creek 355 | 568


185 Unique Binary Search Trees
Given n, how many structurally unique BST’s (binary search trees) that store values 1...n?
For example, Given n = 3, there are a total of 5 unique BST’s.

1 3 3 2 1
\ / / / \ \
3 2 1 1 3 2
/ / \ \
2 1 2 3

185.1 Analysis
Let count[i] be the number of unique binary search trees for i. The number of trees are determined by the number
of subtrees which have different root node. For example,

i=0, count[0]=1 //empty tree

i=1, count[1]=1 //one tree

i=2, count[2]=count[0]*count[1] // 0 is root


+ count[1]*count[0] // 1 is root

i=3, count[3]=count[0]*count[2] // 1 is root


+ count[1]*count[1] // 2 is root
+ count[2]*count[0] // 3 is root

i=4, count[4]=count[0]*count[3] // 1 is root


+ count[1]*count[2] // 2 is root
+ count[2]*count[1] // 3 is root
+ count[3]*count[0] // 4 is root
..
..
..

i=n, count[n] = sum(count[0..k]*count[k+1...n]) 0 <= k < n-1

Use dynamic programming to solve the problem.

185.2 Java Solution

public int numTrees(int n) {


int[] count = new int[n + 1];

count[0] = 1;
count[1] = 1;

for (int i = 2; i <= n; i++) {

356 | 568
185 Unique Binary Search Trees

for (int j = 0; j <= i - 1; j++) {


count[i] = count[i] + count[j] * count[i - j - 1];
}
}

return count[n];
}

Check out how to get all unique binary search trees.

Program Creek 357 | 568


186 Unique Binary Search Trees II
Given n, generate all structurally unique BST’s (binary search trees) that store values 1...n.
For example, Given n = 3, your program should return all 5 unique BST’s shown below.

1 3 3 2 1
\ / / / \ \
3 2 1 1 3 2
/ / \ \
2 1 2 3

186.1 Analysis
Check out Unique Binary Search Trees I.
This problem can be solved by recursively forming left and right subtrees. The different combinations of left
and right subtrees form the set of all unique binary search trees.

186.2 Java Solution

public List<TreeNode> generateTrees(int n) {


if(n==0){
return new ArrayList<TreeNode>();
}

return helper(1, n);


}

public List<TreeNode> helper(int m, int n){


List<TreeNode> result = new ArrayList<TreeNode>();
if(m>n){
[Link](null);
return result;
}

for(int i=m; i<=n; i++){


List<TreeNode> ls = helper(m, i-1);
List<TreeNode> rs = helper(i+1, n);
for(TreeNode l: ls){
for(TreeNode r: rs){
TreeNode curr = new TreeNode(i);
[Link]=l;
[Link]=r;
[Link](curr);
}
}
}

return result;

358 | 568
186 Unique Binary Search Trees II

Program Creek 359 | 568


187 Sum Root to Leaf Numbers
Given a binary tree containing digits from 0-9 only, each root-to-leaf path could represent a number. Find the
total sum of all root-to-leaf numbers.
For example,

1
/ \
2 3

The root-to-leaf path 1->2 represents the number 12. The root-to-leaf path 1->3 represents the number 13.
Return the sum = 12 + 13 = 25.

187.1 Java Solution - Recursive


This problem can be solved by a typical DFS approach.

public int sumNumbers(TreeNode root) {


int result = 0;
if(root==null)
return result;

ArrayList<ArrayList<TreeNode>> all = new ArrayList<ArrayList<TreeNode>>();


ArrayList<TreeNode> l = new ArrayList<TreeNode>();
[Link](root);
dfs(root, l, all);

for(ArrayList<TreeNode> a: all){
StringBuilder sb = new StringBuilder();
for(TreeNode n: a){
[Link]([Link]([Link]));
}
int currValue = [Link]([Link]());
result = result + currValue;
}

return result;
}

public void dfs(TreeNode n, ArrayList<TreeNode> l, ArrayList<ArrayList<TreeNode>> all){


if([Link]==null && [Link]==null){
ArrayList<TreeNode> t = new ArrayList<TreeNode>();
[Link](l);
[Link](t);
}

if([Link]!=null){
[Link]([Link]);
dfs([Link], l, all);
[Link]([Link]()-1);
}

360 | 568
187 Sum Root to Leaf Numbers

if([Link]!=null){
[Link]([Link]);
dfs([Link], l, all);
[Link]([Link]()-1);
}

Same approach, but simpler coding style.

public int sumNumbers(TreeNode root) {


if(root == null)
return 0;

return dfs(root, 0, 0);


}

public int dfs(TreeNode node, int num, int sum){


if(node == null) return sum;

num = num*10 + [Link];

// leaf
if([Link] == null && [Link] == null) {
sum += num;
return sum;
}

// left subtree + right subtree


sum = dfs([Link], num, sum) + dfs([Link], num, sum);
return sum;
}

Program Creek 361 | 568


188 Count Complete Tree Nodes
Given a complete binary tree, count the number of nodes.
The solution to this problem can be as simple as the following:

public int countNodes(TreeNode root) {


if(root == null){
return 0;
}

return 1 + countNodes([Link]) + countNodes([Link]);


}

The following two solutions are improvements to this solution. The idea is that we can skip some elements to
reduce time in the average case.

188.1 Java Solution 1


Steps to solve this problem: 1) get the height of left-most part 2) get the height of right-most part 3) when they
are equal, the # of nodes = 2ĥ -1 4) when they are not equal, recursively get # of nodes from left&right sub-trees

public int countNodes(TreeNode root) {


if(root==null)
return 0;

362 | 568
188 Count Complete Tree Nodes

int left = getLeftHeight(root)+1;


int right = getRightHeight(root)+1;

if(left==right){
return (2<<(left-1))-1;
}else{
return countNodes([Link])+countNodes([Link])+1;
}
}

public int getLeftHeight(TreeNode n){


if(n==null) return 0;

int height=0;
while([Link]!=null){
height++;
n = [Link];
}
return height;
}

public int getRightHeight(TreeNode n){


if(n==null) return 0;

int height=0;
while([Link]!=null){
height++;
n = [Link];
}
return height;
}

Each time, you will have to do traversals along the left and right edges. At level h, you iterate zero times (no
child). At level h - 1, you iterate once (one child). And so on. So that is 0 + 1 + 2 + ... + h steps just to compute
the left edges, which is h(1 + h)/2 = O(h2̂). The countNodes part has f(n) = 2 * 2 ...* 2 = 2ĥ which is the number
of nodes. Therefore, the time complexity is bounded by O(n) where n is the number of nodes in the tree.

188.2 Java Solution 2

public int countNodes(TreeNode root) {


int h = getHeight(root);
int total = (int)[Link](2, h)-1;

//get num missed


int[] miss = new int[1];
helper(root, 0, h, miss);

return total - miss[0];


}

//true continue, false stop


private boolean helper(TreeNode t, int level, int height, int[] miss){
if(t!=null){
level++;
}else{
return true;

Program Creek 363 | 568


188 Count Complete Tree Nodes

if(level >=height){
return false;
}

if(level == height-1){
if([Link] == null){
miss[0]++;
}
if([Link] == null){
miss[0]++;
}

if([Link]!=null){
return false;
}
}

boolean r = helper([Link], level, height, miss);


if(r){
boolean l = helper([Link], level, height, miss);
return l;
}

return true;
}

private int getHeight(TreeNode root){


TreeNode p = root;
int h = 0;
while(p!=null){
h++;
p = [Link];
}
return h;
}

The sum of total node can also be written as:

int total = (2 << (h-1)) - 1;

Average time complexity is O(n/2), which is half of the number of nodes in the tree.

Program Creek 364 | 568


189 Closest Binary Search Tree Value
Given a non-empty binary search tree and a target value, find the value in the BST that is closest to the target.

189.1 Java Solution 1 - Recursion


Recursively traverse down the root. When target is less than root, go left; when target is greater than root, go
right.

public class Solution {


int goal;
double min = Double.MAX_VALUE;

public int closestValue(TreeNode root, double target) {


helper(root, target);
return goal;
}

public void helper(TreeNode root, double target){


if(root==null)
return;

if([Link]([Link] - target) < min){


min = [Link]([Link]-target);
goal = [Link];
}

if(target < [Link]){


helper([Link], target);
}else{
helper([Link], target);
}
}
}

189.2 Java Solution 2 - Iteration

public int closestValue(TreeNode root, double target) {


double min=Double.MAX_VALUE;
int result = [Link];

while(root!=null){
if(target>[Link]){

double diff = [Link]([Link]-target);


if(diff<min){
min = [Link](min, diff);
result = [Link];

365 | 568
189 Closest Binary Search Tree Value

}
root = [Link];
}else if(target<[Link]){

double diff = [Link]([Link]-target);


if(diff<min){
min = [Link](min, diff);
result = [Link];
}
root = [Link];
}else{
return [Link];
}
}

return result;
}

Program Creek 366 | 568


190 Binary Tree Paths
Given a binary tree, return all root-to-leaf paths.

190.1 Naive DFS Solution


A typical depth-first search problem.

public List<String> binaryTreePaths(TreeNode root) {


ArrayList<String> finalResult = new ArrayList<String>();

if(root==null)
return finalResult;

ArrayList<String> curr = new ArrayList<String>();


ArrayList<ArrayList<String>> results = new ArrayList<ArrayList<String>>();

dfs(root, results, curr);

for(ArrayList<String> al : results){
StringBuilder sb = new StringBuilder();
[Link]([Link](0));
for(int i=1; i<[Link]();i++){
[Link]("->"+[Link](i));
}

[Link]([Link]());
}

return finalResult;
}

public void dfs(TreeNode root, ArrayList<ArrayList<String>> list, ArrayList<String> curr){


[Link]([Link]([Link]));

if([Link]==null && [Link]==null){


[Link](curr);
return;
}

if([Link]!=null){
ArrayList<String> temp = new ArrayList<String>(curr);
dfs([Link], list, temp);
}

if([Link]!=null){
ArrayList<String> temp = new ArrayList<String>(curr);
dfs([Link], list, temp);
}
}

367 | 568
190 Binary Tree Paths

190.2 Simplified DFS Solution


This depth-first solution can be much simplified like the following:

public List<String> binaryTreePaths(TreeNode root) {

String sb = "";
ArrayList<String> result = new ArrayList<String>();

helper(root, result, sb);

return result;
}

public void helper(TreeNode root, ArrayList<String> result, String s){


if(root==null){
return;
}

s = s+"->"+[Link];

if([Link]==null &&[Link]==null){
[Link]([Link](2));
return;
}

if([Link]!=null){
helper([Link], result, s);
}
if([Link]!=null){
helper([Link], result, s);
}
}

Program Creek 368 | 568


191 Maximum Depth of Binary Tree
Given a binary tree, find its maximum depth.
The maximum depth is the number of nodes along the longest path from the root node down to the farthest
leaf node.

191.1 Java Solution

public int maxDepth(TreeNode root) {


if(root==null)
return 0;

int leftDepth = maxDepth([Link]);


int rightDepth = maxDepth([Link]);

int bigger = [Link](leftDepth, rightDepth);

return bigger+1;
}

369 | 568
192 Recover Binary Search Tree
Two elements of a binary search tree (BST) are swapped by mistake. Recover the tree without changing its
structure.

192.1 Java Solution


Inorder traveral will return values in an increasing order. So if an element is less than its previous element,the
previous element is a swapped node.

public class Solution {


TreeNode first;
TreeNode second;
TreeNode pre;

public void inorder(TreeNode root){


if(root==null)
return;

inorder([Link]);

if(pre==null){
pre=root;
}else{
if([Link]<[Link]){
if(first==null){
first=pre;
}

second=root;
}
pre=root;
}

inorder([Link]);
}

public void recoverTree(TreeNode root) {


if(root==null)
return;

inorder(root);
if(second!=null && first !=null){
int val = [Link];
[Link] = [Link];
[Link] = val;
}

}
}

370 | 568
193 Same Tree
Two binary trees are considered the same if they have identical structure and nodes have the same value.
This problem can be solved by using a simple recursive function.

public boolean isSameTree(TreeNode p, TreeNode q) {


if(p==null && q==null){
return true;
}else if(p==null || q==null){
return false;
}

if([Link]==[Link]){
return isSameTree([Link], [Link]) && isSameTree([Link], [Link]);
}else{
return false;
}
}

371 | 568
194 Serialize and Deserialize Binary Tree
Design an algorithm to serialize and deserialize a binary tree. There is no restriction on how your serializa-
tion/deserialization algorithm should work. You just need to ensure that a binary tree can be serialized to a
string and this string can be deserialized to the original tree structure.

194.1 Java Solution 1 - Level Order Traveral

// Encodes a tree to a single string.


public String serialize(TreeNode root) {
if(root==null){
return "";
}

StringBuilder sb = new StringBuilder();

LinkedList<TreeNode> queue = new LinkedList<TreeNode>();

[Link](root);
while(![Link]()){
TreeNode t = [Link]();
if(t!=null){
[Link]([Link]([Link]) + ",");
[Link]([Link]);
[Link]([Link]);
}else{
[Link]("#,");
}
}

[Link]([Link]()-1);
[Link]([Link]());
return [Link]();
}

// Decodes your encoded data to tree.


public TreeNode deserialize(String data) {
if(data==null || [Link]()==0)
return null;

String[] arr = [Link](",");


TreeNode root = new TreeNode([Link](arr[0]));

LinkedList<TreeNode> queue = new LinkedList<TreeNode>();


[Link](root);

int i=1;
while(![Link]()){
TreeNode t = [Link]();

372 | 568
194 Serialize and Deserialize Binary Tree

if(t==null)
continue;

if(!arr[i].equals("#")){
[Link] = new TreeNode([Link](arr[i]));
[Link]([Link]);

}else{
[Link] = null;
[Link](null);
}
i++;

if(!arr[i].equals("#")){
[Link] = new TreeNode([Link](arr[i]));
[Link]([Link]);

}else{
[Link] = null;
[Link](null);
}
i++;
}

return root;
}

194.2 Java Solution 2 - Preorder Traversal

// Encodes a tree to a single string.


public String serialize(TreeNode root) {
if(root==null)
return null;

Stack<TreeNode> stack = new Stack<TreeNode>();


[Link](root);
StringBuilder sb = new StringBuilder();

while(![Link]()){
TreeNode h = [Link]();
if(h!=null){
[Link]([Link]+",");
[Link]([Link]);
[Link]([Link]);
}else{
[Link]("#,");
}
}

return [Link]().substring(0, [Link]()-1);


}

// Decodes your encoded data to tree.


public TreeNode deserialize(String data) {

Program Creek 373 | 568


194 Serialize and Deserialize Binary Tree

if(data == null)
return null;

int[] t = {0};
String[] arr = [Link](",");

return helper(arr, t);


}

public TreeNode helper(String[] arr, int[] t){


if(arr[t[0]].equals("#")){
return null;
}

TreeNode root = new TreeNode([Link](arr[t[0]]));

t[0]=t[0]+1;
[Link] = helper(arr, t);
t[0]=t[0]+1;
[Link] = helper(arr, t);

return root;
}

Program Creek 374 | 568


195 Inorder Successor in BST
Given a binary search tree and a node in it, find the in-order successor of that node in the BST.

// Definition for a binary tree node.


public class TreeNode {
int val;
TreeNode left;
TreeNode right;
TreeNode(int x) { val = x; }
}

195.1 Java Solution


The node does not have a pointer pointing to its parent. This is different from Inorder Successor in BST II.

public TreeNode inorderSuccessor(TreeNode root, TreeNode p) {


if(root==null)
return null;

TreeNode next = null;


TreeNode c = root;
while(c!=null && [Link]!=[Link]){
if([Link] > [Link]){
next = c;
c = [Link];
}else{
c= [Link];
}
}

if(c==null)
return null;

if([Link]==null)
return next;

c = [Link];
while([Link]!=null)
c = [Link];

return c;
}

When the tree is balanced, time complexity is O(log(n)) and space is O(1). The worst case time complexity is
O(n).

375 | 568
196 Inorder Successor in BST II
Given a binary search tree and a node in it, find the in-order successor of that node in the BST.
The successor of a node p is the node with the smallest key greater than [Link]. You will have direct access to
the node but not to the root of the tree. Each node will have a reference to its parent node. A node is defined as
the following:

// Definition for a Node.


class Node {
public int val;
public Node left;
public Node right;
public Node parent;
};
*/

196.1 Java Solution

public Node inorderSuccessor(Node x) {


Node result = null;

//case 1: right child is not null -> go down to get the next
Node p = [Link];
while(p!=null){
result = p;
p = [Link];
}

if(result != null){
return result;
}

//case 2: right child is null -> go up to the parent,


//until the node is a left child, return the parent
p = x;

while(p!=null){
if([Link]!=null && [Link]==p){
return [Link];
}
p = [Link];
}

return null;
}

376 | 568
196 Inorder Successor in BST II

If the tree is balanced, the time complexity is the height of the tree - O(log(n)). In the worst cast, the time is
O(n). Space complexity is constant.

Program Creek 377 | 568


197 Find Leaves of Binary Tree
Given a binary tree, collect a tree’s nodes as if you were doing this: Collect and remove all leaves, repeat until the
tree is empty.
Example: Given binary tree

1
/ \
2 3
/ \
4 5

Returns [4, 5, 3], [2], [1].

197.1 Java Solution 1


Naively, we can get the order of each node, store them in a hashmap and then iterate over the hashmap to get the
list.

public List<List<Integer>> findLeaves(TreeNode root) {


HashMap<TreeNode, Integer> map=new HashMap<>();
helper(root, map);

int min = Integer.MAX_VALUE;


int max = Integer.MIN_VALUE;
HashMap<Integer, HashSet<TreeNode>> reversed = new HashMap<>();

for([Link]<TreeNode, Integer> entry: [Link]()){


min = [Link](min, [Link]());
max = [Link](max, [Link]());

HashSet<TreeNode> set = [Link]([Link](), new HashSet<TreeNode>());


[Link]([Link]());
[Link]([Link](), set);
}

List<List<Integer>> result = new ArrayList<List<Integer>>();


for(int i=min; i<=max; i++){
HashSet<TreeNode> set = [Link](i);
ArrayList<Integer> l = new ArrayList<>();
for(TreeNode td: set){
[Link]([Link]);
}
[Link](l);
}

return result;
}

private int helper(TreeNode root, HashMap<TreeNode, Integer> map){

378 | 568
197 Find Leaves of Binary Tree

if(root==null){
return 0;
}

int left = helper([Link], map);


int right = helper([Link], map);

int order = [Link](left, right)+1;


[Link](root, order);
return order;
}

197.2 Java Solution 2 - Optomized


The key to solve this problem is converting the problem to be finding the index of the element in the result list.
Then this is a typical DFS problem on trees.

public List<List<Integer>> findLeaves(TreeNode root) {


List<List<Integer>> result = new ArrayList<List<Integer>>();
helper(result, root);
return result;
}

// traverse the tree bottom-up recursively


private int helper(List<List<Integer>> list, TreeNode root){
if(root==null)
return -1;

int left = helper(list, [Link]);


int right = helper(list, [Link]);
int curr = [Link](left, right)+1;

// the first time this code is reached is when curr==0,


//since the tree is bottom-up processed.
if([Link]()<=curr){
[Link](new ArrayList<Integer>());
}

[Link](curr).add([Link]);

return curr;
}

Program Creek 379 | 568


198 Largest BST Subtree
Given a binary tree, find the largest subtree which is a Binary Search Tree (BST), where largest means subtree
with largest number of nodes in it.

198.1 Java Solution

class Wrapper{
int size;
int lower, upper;
boolean isBST;

public Wrapper(){
lower = Integer.MAX_VALUE;
upper = Integer.MIN_VALUE;
isBST = false;
size = 0;
}
}
public class Solution {
public int largestBSTSubtree(TreeNode root) {
return helper(root).size;
}

public Wrapper helper(TreeNode node){


Wrapper curr = new Wrapper();

if(node == null){
[Link]= true;
return curr;
}

Wrapper l = helper([Link]);
Wrapper r = helper([Link]);

//current subtree’s boundaries


[Link] = [Link]([Link], [Link]);
[Link] = [Link]([Link], [Link]);

//check left and right subtrees are BST or not


//check left’s upper again current’s value and right’s lower against current’s value
if([Link] && [Link] && [Link]<=[Link] && [Link]>=[Link]){
[Link] = [Link]+[Link]+1;
[Link] = true;
}else{
[Link] = [Link]([Link], [Link]);
[Link] = false;
}

return curr;

380 | 568
198 Largest BST Subtree

}
}

Program Creek 381 | 568


199 Implement Trie (Prefix Tree)
Implement a trie with insert, search, and startsWith methods.

199.1 Java Solution 1


A trie node should contains the character, its children and the flag that marks if it is a leaf node. You can use the
trie in the following diagram to walk though the Java solution.

class TrieNode {
char c;
HashMap<Character, TrieNode> children = new HashMap<Character, TrieNode>();
boolean isLeaf;

public TrieNode() {}

public TrieNode(char c){


this.c = c;
}
}

public class Trie {


private TrieNode root;

public Trie() {
root = new TrieNode();
}

// Inserts a word into the trie.


public void insert(String word) {
HashMap<Character, TrieNode> children = [Link];

for(int i=0; i<[Link](); i++){


char c = [Link](i);

382 | 568
199 Implement Trie (Prefix Tree)

TrieNode t;
if([Link](c)){
t = [Link](c);
}else{
t = new TrieNode(c);
[Link](c, t);
}

children = [Link];

//set leaf node


if(i==[Link]()-1)
[Link] = true;
}
}

// Returns if the word is in the trie.


public boolean search(String word) {
TrieNode t = searchNode(word);

if(t != null && [Link])


return true;
else
return false;
}

// Returns if there is any word in the trie


// that starts with the given prefix.
public boolean startsWith(String prefix) {
if(searchNode(prefix) == null)
return false;
else
return true;
}

public TrieNode searchNode(String str){


Map<Character, TrieNode> children = [Link];
TrieNode t = null;
for(int i=0; i<[Link](); i++){
char c = [Link](i);
if([Link](c)){
t = [Link](c);
children = [Link];
}else{
return null;
}
}

return t;
}
}

199.2 Java Solution 2 - Improve Performance by Using an Array


Each trie node can only contains ’a’-’z’ characters. So we can use a small array to store the character.

Program Creek 383 | 568


199 Implement Trie (Prefix Tree)

class TrieNode {
TrieNode[] arr;
boolean isEnd;
// Initialize your data structure here.
public TrieNode() {
[Link] = new TrieNode[26];
}

public class Trie {


private TrieNode root;

public Trie() {
root = new TrieNode();
}

// Inserts a word into the trie.


public void insert(String word) {
TrieNode p = root;
for(int i=0; i<[Link](); i++){
char c = [Link](i);
int index = c-’a’;
if([Link][index]==null){
TrieNode temp = new TrieNode();
[Link][index]=temp;
p = temp;
}else{
p=[Link][index];
}
}
[Link]=true;
}

// Returns if the word is in the trie.


public boolean search(String word) {
TrieNode p = searchNode(word);
if(p==null){
return false;
}else{
if([Link])
return true;
}

return false;
}

// Returns if there is any word in the trie


// that starts with the given prefix.
public boolean startsWith(String prefix) {
TrieNode p = searchNode(prefix);
if(p==null){
return false;
}else{
return true;
}
}

Program Creek 384 | 568


199 Implement Trie (Prefix Tree)

public TrieNode searchNode(String s){


TrieNode p = root;
for(int i=0; i<[Link](); i++){
char c= [Link](i);
int index = c-’a’;
if([Link][index]!=null){
p = [Link][index];
}else{
return null;
}
}

if(p==root)
return null;

return p;
}
}

If the same words can be inserted more than once, what do you need to change to make it work?

Program Creek 385 | 568


200 Add and Search Word Data structure design
Design a data structure that supports the following two operations:

void addWord(word)
bool search(word)

search(word) can search a literal word or a regular expression string containing only letters a-z or .. A . means
it can represent any one letter.

200.1 Java Solution 1


This problem is similar with Implement Trie. The solution 1 below uses the same definition of a trie node. To
handle the "." case for this problem, we need to search all possible paths, instead of one path.
TrieNode

class TrieNode{
char c;
HashMap<Character, TrieNode> children = new HashMap<Character, TrieNode>();
boolean isLeaf;

public TrieNode() {}

public TrieNode(char c){


this.c = c;
}
}

WordDictionary

public class WordDictionary {


private TrieNode root;

public WordDictionary(){
root = new TrieNode();
}

// Adds a word into the data structure.


public void addWord(String word) {
HashMap<Character, TrieNode> children = [Link];

for(int i=0; i<[Link](); i++){


char c = [Link](i);

TrieNode t = null;
if([Link](c)){
t = [Link](c);
}else{
t = new TrieNode(c);
[Link](c,t);
}

386 | 568
200 Add and Search Word Data structure design

children = [Link];

if(i == [Link]()-1){
[Link] = true;
}
}
}

// Returns if the word is in the data structure. A word could


// contain the dot character ’.’ to represent any one letter.
public boolean search(String word) {
return dfsSearch([Link], word, 0);

public boolean dfsSearch(HashMap<Character, TrieNode> children, String word, int start) {


if(start == [Link]()){
if([Link]()==0)
return true;
else
return false;
}

char c = [Link](start);

if([Link](c)){
if(start == [Link]()-1 && [Link](c).isLeaf){
return true;
}

return dfsSearch([Link](c).children, word, start+1);


}else if(c == ’.’){
boolean result = false;
for([Link]<Character, TrieNode> child: [Link]()){
if(start == [Link]()-1 && [Link]().isLeaf){
return true;
}

//if any path is true, set result to be true;


if(dfsSearch([Link]().children, word, start+1)){
result = true;
}
}

return result;
}else{
return false;
}
}
}

200.2 Java Solution 2 - Using Array Instead of HashMap

class TrieNode{

Program Creek 387 | 568


200 Add and Search Word Data structure design

TrieNode[] arr;
boolean isLeaf;

public TrieNode(){
arr = new TrieNode[26];
}
}

public class WordDictionary {


TrieNode root;

public WordDictionary(){
root = new TrieNode();
}
// Adds a word into the data structure.
public void addWord(String word) {
TrieNode p= root;
for(int i=0; i<[Link](); i++){
char c=[Link](i);
int index = c-’a’;
if([Link][index]==null){
TrieNode temp = new TrieNode();
[Link][index]=temp;
p=temp;
}else{
p=[Link][index];
}
}

[Link]=true;
}

// Returns if the word is in the data structure. A word could


// contain the dot character ’.’ to represent any one letter.
public boolean search(String word) {
return dfsSearch(root, word, 0);
}

public boolean dfsSearch(TrieNode p, String word, int start) {


if ([Link] && start == [Link]())
return true;

if (start >= [Link]())


return false;

char c = [Link](start);

if (c == ’.’) {
boolean tResult = false;
for (int j = 0; j < 26; j++) {
if ([Link][j] != null) {
if (dfsSearch([Link][j], word, start + 1)) {
tResult = true;
break;
}
}
}

Program Creek 388 | 568


200 Add and Search Word Data structure design

if (tResult)
return true;
} else {
int index = c - ’a’;

if ([Link][index] != null) {
return dfsSearch([Link][index], word, start + 1);
} else {
return false;
}
}

return false;
}
}

Program Creek 389 | 568


201 Range Sum Query Mutable
Given an integer array nums, find the sum of the elements between indices i and j (i ≤ j), inclusive. The update(i,
val) function modifies nums by updating the element at index i to val.

201.1 Java Solution 1 - Segment Tree

class TreeNode{
int start;
int end;
int sum;
TreeNode leftChild;
TreeNode rightChild;

public TreeNode(int left, int right, int sum){


[Link]=left;
[Link]=right;
[Link]=sum;
}
public TreeNode(int left, int right){
[Link]=left;
[Link]=right;
[Link]=0;
}

390 | 568
201 Range Sum Query Mutable

public class NumArray {


TreeNode root = null;

public NumArray(int[] nums) {


if(nums==null || [Link]==0)
return;

[Link] = buildTree(nums, 0, [Link]-1);


}

void update(int i, int val) {


updateHelper(root, i, val);
}

void updateHelper(TreeNode root, int i, int val){


if(root==null)
return;

int mid = [Link] + ([Link])/2;


if(i<=mid){
updateHelper([Link], i, val);
}else{
updateHelper([Link], i, val);
}

if([Link]==[Link]&& [Link]==i){
[Link]=val;
return;
}

[Link]=[Link]+[Link];
}

public int sumRange(int i, int j) {


return sumRangeHelper(root, i, j);
}

public int sumRangeHelper(TreeNode root, int i, int j){


if(root==null || j<[Link] || i > [Link] ||i>j )
return 0;

if(i<=[Link] && j>=[Link]){


return [Link];
}
int mid = [Link] + ([Link])/2;
int result = sumRangeHelper([Link], i, [Link](mid, j))
+sumRangeHelper([Link], [Link](mid+1, i), j);

return result;
}

public TreeNode buildTree(int[] nums, int i, int j){


if(nums==null || [Link]==0|| i>j)
return null;

Program Creek 391 | 568


201 Range Sum Query Mutable

if(i==j){
return new TreeNode(i, j, nums[i]);
}

TreeNode current = new TreeNode(i, j);

int mid = i + (j-i)/2;

[Link] = buildTree(nums, i, mid);


[Link] = buildTree(nums, mid+1, j);

[Link] = [Link]+[Link];

return current;
}
}

201.2 Java Solution 2 - Binary Index Tree / Fenwick Tree


Here is a perfect video to show how binary index tree works. In addition, my notes at the end of the post may
also help.

public class NumArray {

int[] btree;
int[] arr;

public NumArray(int[] nums) {


btree = new int[[Link]+1];
arr = nums;

for(int i=0; i<[Link]; i++){


add(i+1, nums[i]);
}
}

void add(int i, int val) {


for(int j=i; j<[Link]; j=j+(j&(-j)) ){
btree[j] += val;
}
}

void update(int i, int val) {


add(i+1, val-arr[i]);
arr[i]=val;
}

public int sumRange(int i, int j) {


return sumHelper(j+1)-sumHelper(i);
}

public int sumHelper(int i){


int sum=0;
for(int j=i; j>=1; j=j-(j&(-j))){
sum += btree[j];

Program Creek 392 | 568


201 Range Sum Query Mutable

}
return sum;
}
}

Program Creek 393 | 568


202 The Skyline Problem

202.1 Analysis
This problem is essentially a problem of processing 2*n edges. Each edge has a x-axis value and a height value.
The key part is how to use the height heap to process each edge.

202.2 Java Solution

class Edge {
int x;
int height;
boolean isStart;

public Edge(int x, int height, boolean isStart) {


this.x = x;
[Link] = height;
[Link] = isStart;
}
}

public List<int[]> getSkyline(int[][] buildings) {


List<int[]> result = new ArrayList<int[]>();

if (buildings == null || [Link] == 0


|| buildings[0].length == 0) {
return result;
}

List<Edge> edges = new ArrayList<Edge>();

// add all left/right edges


for (int[] building : buildings) {
Edge startEdge = new Edge(building[0], building[2], true);
[Link](startEdge);
Edge endEdge = new Edge(building[1], building[2], false);
[Link](endEdge);
}

// sort edges
[Link](edges, new Comparator<Edge>() {
public int compare(Edge a, Edge b) {
if (a.x != b.x)
return [Link](a.x, b.x);

if ([Link] && [Link]) {


return [Link]([Link], [Link]);
}

394 | 568
202 The Skyline Problem

if (![Link] && ![Link]) {


return [Link]([Link], [Link]);
}

return [Link] ? -1 : 1;
}
});

// process edges
PriorityQueue<Integer> heightHeap = new PriorityQueue<Integer>(10, [Link]());

for (Edge edge : edges) {


if ([Link]) {
if ([Link]() || [Link] > [Link]()) {
[Link](new int[] { edge.x, [Link] });
}
[Link]([Link]);
} else {
[Link]([Link]);

if([Link]()){
[Link](new int[] {edge.x, 0});
}else if([Link] > [Link]()){
[Link](new int[]{edge.x, [Link]()});
}
}
}

return result;
}

Program Creek 395 | 568


203 Implement Stack using Queues
Implement the following operations of a stack using queues. push(x) – Push element x onto stack. pop() –
Removes the element on top of the stack. top() – Get the top element. empty() – Return whether the stack is
empty.
Note: only standard queue operations are allowed, i.e., poll(), offer(), peek(), size() and isEmpty() in Java.

203.1 Analysis
This problem can be solved by using two queues.

203.2 Java Solution

class MyStack {
LinkedList<Integer> queue1 = new LinkedList<Integer>();
LinkedList<Integer> queue2 = new LinkedList<Integer>();

// Push element x onto stack.


public void push(int x) {
if(empty()){
[Link](x);
}else{
if([Link]()>0){
[Link](x);
int size = [Link]();
while(size>0){
[Link]([Link]());
size--;
}
}else if([Link]()>0){
[Link](x);
int size = [Link]();
while(size>0){
[Link]([Link]());
size--;
}
}
}
}

// Removes the element on top of the stack.


public void pop() {
if([Link]()>0){
[Link]();
}else if([Link]()>0){
[Link]();
}
}

396 | 568
203 Implement Stack using Queues

// Get the top element.


public int top() {
if([Link]()>0){
return [Link]();
}else if([Link]()>0){
return [Link]();
}
return 0;
}

// Return whether the stack is empty.


public boolean empty() {
return [Link]() & [Link]();
}
}

Program Creek 397 | 568


204 Implement Queue using Stacks
Implement the following operations of a queue using stacks.
push(x) – Push element x to the back of queue. pop() – Removes the element from in front of queue. peek() –
Get the front element. empty() – Return whether the queue is empty.

204.1 Java Solution

class MyQueue {

Stack<Integer> temp = new Stack<Integer>();


Stack<Integer> value = new Stack<Integer>();

// Push element x to the back of queue.


public void push(int x) {
if([Link]()){
[Link](x);
}else{
while(![Link]()){
[Link]([Link]());
}

[Link](x);

while(![Link]()){
[Link]([Link]());
}
}
}

// Removes the element from in front of queue.


public void pop() {
[Link]();
}

// Get the front element.


public int peek() {
return [Link]();
}

// Return whether the queue is empty.


public boolean empty() {
return [Link]();
}
}

398 | 568
205 Implement a Stack Using an Array in Java
This post shows how to implement a stack by using an array.
The requirements of the stack are: 1) the stack has a constructor which accepts a number to initialize its size,
2) the stack can hold any type of elements, 3) the stack has a push() and a pop() method.

205.1 A Simple Stack Implementation

public class Stack<E> {


private E[] arr = null;
private int CAP;
private int top = -1;
private int size = 0;

@SuppressWarnings("unchecked")
public Stack(int cap) {
[Link] = cap;
[Link] = (E[]) new Object[cap];
}

public E pop() {
if([Link] == 0){
return null;
}

[Link]--;
E result = [Link][top];
[Link][top] = null;//prevent memory leaking
[Link]--;

return result;
}

public boolean push(E e) {


if (isFull())
return false;

[Link]++;
[Link][++top] = e;

return true;
}

public boolean isFull() {


if ([Link] == [Link])
return false;
return true;
}

public String toString() {

399 | 568
205 Implement a Stack Using an Array in Java

if([Link]==0){
return null;
}

StringBuilder sb = new StringBuilder();


for(int i=0; i<[Link]; i++){
[Link]([Link][i] + ", ");
}

[Link]([Link]()-2);
return [Link]();
}

public static void main(String[] args) {

Stack<String> stack = new Stack<String>(11);


[Link]("hello");
[Link]("world");

[Link](stack);

[Link]();
[Link](stack);

[Link]();
[Link](stack);
}
}

Output:

hello, world
hello
null

This example is used twice in "Effective Java". In the first place, the stack example is used to illustrate memory
leak. In the second place, the example is used to illustrate when we can suppress unchecked warnings.
You may check out how to implement a queue by using an array.

Program Creek 400 | 568


206 Implement a Queue using an Array in Java
There following Java code shows how to implement a queue without using any extra data structures in Java. We
can implement a queue by using an array.

import [Link];
import [Link];

public class Queue<E> {

E[] arr;
int head = -1;
int tail = -1;
int size;

public Queue(Class<E> c, int size) {


E[] newInstance = (E[]) [Link](c, size);
[Link] = newInstance;
[Link] = 0;
}

boolean push(E e) {
if (size == [Link])
return false;

head = (head + 1) % [Link];


arr[head] = e;
size++;

if(tail == -1){
tail = head;
}

return true;
}

boolean pop() {
if (size == 0) {
return false;
}

401 | 568
206 Implement a Queue using an Array in Java

E result = arr[tail];
arr[tail] = null;
size--;
tail = (tail+1)%[Link];

if (size == 0) {
head = -1;
tail = -1;
}

return true;
}

E peek(){
if(size==0)
return null;

return arr[tail];
}

public int size() {


return [Link];
}

public String toString() {


return [Link]([Link]);
}

public static void main(String[] args) {


Queue<Integer> q = new Queue<Integer>([Link], 5);
[Link](1);
[Link](2);
[Link](3);
[Link](4);
[Link](5);
[Link]();
[Link](6);
[Link](q);
}
}

Program Creek 402 | 568


207 Evaluate Reverse Polish Notation
Evaluate the value of an arithmetic expression in Reverse Polish Notation. Valid operators are +, -, *, /. Each
operand may be an integer or another expression. For example:

["2", "1", "+", "3", "*"] -> ((2 + 1) * 3) -> 9


["4", "13", "5", "/", "+"] -> (4 + (13 / 5)) -> 6

207.1 Naive Approach


This problem can be solved by using a stack. We can loop through each element in the given array. When it is
a number, push it to the stack. When it is an operator, pop two numbers from the stack, do the calculation, and
push back the result.

The following is the code. However, this code contains compilation errors in leetcode. Why?

public class Test {

public static void main(String[] args) throws IOException {


String[] tokens = new String[] { "2", "1", "+", "3", "*" };
[Link](evalRPN(tokens));
}

public static int evalRPN(String[] tokens) {


int returnValue = 0;
String operators = "+-*/";

403 | 568
207 Evaluate Reverse Polish Notation

Stack<String> stack = new Stack<String>();

for (String t : tokens) {


if (![Link](t)) { //push to stack if it is a number
[Link](t);
} else {//pop numbers from stack if it is an operator
int a = [Link]([Link]());
int b = [Link]([Link]());
switch (t) {
case "+":
[Link]([Link](a + b));
break;
case "-":
[Link]([Link](b - a));
break;
case "*":
[Link]([Link](a * b));
break;
case "/":
[Link]([Link](b / a));
break;
}
}
}

returnValue = [Link]([Link]());

return returnValue;
}
}

The problem is that switch string statement is only available from JDK 1.7. Leetcode apparently use a JDK
version below 1.7.

207.2 Accepted Solution


If you want to use switch statement, you can convert the above by using the following code which use the index
of a string "+-*/".

public class Solution {


public int evalRPN(String[] tokens) {

int returnValue = 0;

String operators = "+-*/";

Stack<String> stack = new Stack<String>();

for(String t : tokens){
if(![Link](t)){
[Link](t);
}else{
int a = [Link]([Link]());
int b = [Link]([Link]());
int index = [Link](t);
switch(index){
case 0:

Program Creek 404 | 568


207 Evaluate Reverse Polish Notation

[Link]([Link](a+b));
break;
case 1:
[Link]([Link](b-a));
break;
case 2:
[Link]([Link](a*b));
break;
case 3:
[Link]([Link](b/a));
break;
}
}
}

returnValue = [Link]([Link]());

return returnValue;

}
}

Program Creek 405 | 568


208 Valid Parentheses
Given a string containing just the characters ’(’, ’)’, ’’, ’’, ’[’ and ’]’, determine if the input string is valid. The brackets
must close in the correct order, "()" and "()[]" are all valid but "(]" and "([)]" are not.

208.1 Analysis
A typical problem which can be solved by using a stack data structure.

208.2 Java Solution

public static boolean isValid(String s) {


HashMap<Character, Character> map = new HashMap<Character, Character>();
[Link](’(’, ’)’);
[Link](’[’, ’]’);
[Link](’{’, ’}’);

Stack<Character> stack = new Stack<Character>();

for (int i = 0; i < [Link](); i++) {


char curr = [Link](i);

if ([Link]().contains(curr)) {
[Link](curr);
} else if ([Link]().contains(curr)) {
if (![Link]() && [Link]([Link]()) == curr) {
[Link]();
} else {
return false;
}
}
}

return [Link]();
}

406 | 568
209 Longest Valid Parentheses
Given a string containing just the characters ’(’ and ’)’, find the length of the longest valid (well-formed) paren-
theses substring.
For "(()", the longest valid parentheses substring is "()", which has length = 2. Another example is ")()())", where
the longest valid parentheses substring is "()()", which has length = 4.

209.1 Java Solution


A stack can be used to track and reduce pairs. Since the problem asks for length, we can put the index into the
stack along with the character. For coding simplicity purpose, we can use 0 to respresnt ( and 1 to represent ).
This problem is similar with Valid Parentheses, which can also be solved by using a stack.

public int longestValidParentheses(String s) {


Stack<int[]> stack = new Stack<>();
int result = 0;

for(int i=0; i<[Link](); i++){


char c = [Link](i);
if(c==’)’){
if(![Link]() && [Link]()[0]==0){
[Link]();
result = [Link](result, i-([Link]()?-1:[Link]()[1]));
}else{
[Link](new int[]{1, i});
}
}else{
[Link](new int[]{0, i});
}
}

return result;
}

407 | 568
210 Min Stack
Design a stack that supports push, pop, top, and retrieving the minimum element in constant time.
push(x) – Push element x onto stack. pop() – Removes the element on top of the stack. top() – Get the top
element. getMin() – Retrieve the minimum element in the stack.

210.1 Java Solution


To make constant time of getMin(), we need to keep track of the minimum element for each element in the stack.
Define an element class that holds element value, min value, and pointer to elements below it.

class Elem{
public int value;
public int min;
public Elem next;

public Elem(int value, int min){


[Link] = value;
[Link] = min;
}
}

public class MinStack {


public Elem top;

/** initialize your data structure here. */


public MinStack() {

public void push(int x) {


if(top == null){
top = new Elem(x, x);
}else{
Elem e = new Elem(x, [Link](x,[Link]));
[Link] = top;
top = e;
}

public void pop() {


if(top == null)
return;
Elem temp = [Link];
[Link] = null;
top = temp;

public int top() {

408 | 568
210 Min Stack

if(top == null)
return -1;
return [Link];
}

public int getMin() {


if(top == null)
return -1;
return [Link];
}
}

Program Creek 409 | 568


211 Max Chunks To Make Sorted
Given an array arr that is a permutation of [0, 1, ..., [Link] - 1], we split the array into some number of "chunks"
(partitions), and individually sort each chunk. After concatenating them, the result equals the sorted array.
What is the most number of chunks we could have made?
For example, given [2,0,1], the method returns 0, as there can only be one chunk.

211.1 Analysis
The key to solve this problem is using a stack to track the existing chunk. Each chunk is represented a min and
max number. Each chunk is essentially an interval and the interval can not overlap.

211.2 Java Solution

public int maxChunksToSorted(int[] arr) {


if(arr==null||[Link]==0){
return 0;
}

// use [min,max] for each chunk


Stack<int[]> stack = new Stack<int[]>();

for(int i=0; i<[Link]; i++){


int min=arr[i];
int max=arr[i];

while(![Link]()){
int[] top = [Link]();

if(arr[i] < top[1]){


min=[Link](top[0], min);
max=[Link](max, top[1]);
[Link]();
}else{
break;
}
}

[Link](new int[]{min,max});
}

return [Link]();
}

Time complexity is O(n).

410 | 568
212 Maximal Rectangle
Given a 2D binary matrix filled with 0’s and 1’s, find the largest rectangle containing all ones and return its area.

212.1 Analysis
This problem can be converted to the "Largest Rectangle in Histogram" problem.

212.2 Java Solution

public int maximalRectangle(char[][] matrix) {


int m = [Link];
int n = m == 0 ? 0 : matrix[0].length;
int[][] height = new int[m][n + 1];

int maxArea = 0;
for (int i = 0; i < m; i++) {
for (int j = 0; j < n; j++) {
if (matrix[i][j] == ’0’) {
height[i][j] = 0;
} else {
height[i][j] = i == 0 ? 1 : height[i - 1][j] + 1;
}
}
}

for (int i = 0; i < m; i++) {


int area = maxAreaInHist(height[i]);
if (area > maxArea) {
maxArea = area;
}
}

return maxArea;
}

private int maxAreaInHist(int[] height) {


Stack<Integer> stack = new Stack<Integer>();

int i = 0;
int max = 0;

while (i < [Link]) {


if ([Link]() || height[[Link]()] <= height[i]) {
[Link](i++);
} else {
int t = [Link]();
max = [Link](max, height[t]
* ([Link]() ? i : i - [Link]() - 1));

411 | 568
212 Maximal Rectangle

}
}

return max;
}

Program Creek 412 | 568


213 Mini Parser

213.1 Given a nested list of integers represented as a string,


implement a parser to deserialize it. Each element is either an
integer, or a list – whose elements may also be integers or other
lists.
Note: You may assume that the string is well-formed:
• String is non-empty.
• String does not contain white spaces.
• String contains only digits and "[],"
For example,

Given s = "[123,[456,[789]]]",

Return a NestedInteger object containing a nested list with 2 elements:

1. An integer containing value 123.


2. A nested list containing two elements:
i. An integer containing value 456.
ii. A nested list with one element:
a. An integer containing value 789.

213.2 Java Solution


To solve this problem, we should add more example to make clear what is the expected output. For example, s =
"[123,[456],789]" is a legal input.

public NestedInteger deserialize(String s) {


Stack<NestedInteger> stack = new Stack<>();
StringBuilder sb = new StringBuilder();

for(int i=0; i<[Link](); i++){


char c = [Link](i);
switch(c){
case ’[’:
NestedInteger ni = new NestedInteger();
[Link](ni);
break;

case ’]’:
if([Link]()>0){ //123, not [456],
[Link]().add(new NestedInteger([Link]([Link]())));
sb=[Link](0, [Link]());
}

413 | 568
213 Mini Parser

NestedInteger top = [Link]();


if([Link]()){
return top;
}else{
[Link]().add(top);
}

break;
case ’,’:
if([Link]()>0){ //hande case "123," not "[456],"
[Link]().add(new NestedInteger([Link]([Link]())));
sb=[Link](0, [Link]());
}

break;

default: //digits
[Link](c);
}
}

//handle case "123"


if([Link]()>0){
return new NestedInteger([Link]([Link]()));
}

return null;
}

Program Creek 414 | 568


214 Flatten Nested List Iterator
Given a nested list of integers, implement an iterator to flatten it. Each element is either an integer, or a list –
whose elements may also be integers or other lists.
For example, given the list [[1,1],2,[1,1]], by calling next repeatedly until hasNext returns false, the order of
elements returned by next should be: [1,1,2,1,1].

214.1 Java Solution 1

public class NestedIterator implements Iterator<Integer> {


Stack<NestedInteger> stack = new Stack<NestedInteger>();

public NestedIterator(List<NestedInteger> nestedList) {


if(nestedList==null)
return;

for(int i=[Link]()-1; i>=0; i--){


[Link]([Link](i));
}
}

@Override
public Integer next() {
return [Link]().getInteger();
}

@Override
public boolean hasNext() {
while(![Link]()){
NestedInteger top = [Link]();
if([Link]()){
return true;
}else{
[Link]();
for(int i=[Link]().size()-1; i>=0; i--){
[Link]([Link]().get(i));
}
}
}

return false;
}
}

214.2 Java Solution 2

public class NestedIterator implements Iterator<Integer> {

415 | 568
214 Flatten Nested List Iterator

Stack<Iterator<NestedInteger>> stack = new Stack<Iterator<NestedInteger>>();


Integer current;

public NestedIterator(List<NestedInteger> nestedList) {


if(nestedList==null)
return;

[Link]([Link]());
}

@Override
public Integer next() {
Integer result = current;
current = null;
return result;
}

@Override
public boolean hasNext() {
while(![Link]() && current==null){
Iterator<NestedInteger> top = [Link]();
if(![Link]()){
[Link]();
continue;
}

NestedInteger n = [Link]();
if([Link]()){
current = [Link]();
return true;
}else{
[Link]([Link]().iterator());
}
}

return false;
}
}

Program Creek 416 | 568


215 Nested List Weight Sum
Given a nested list of integers, return the sum of all integers in the list weighted by their depth.
Each element is either an integer, or a list – whose elements may also be integers or other lists.
Example 1: Given the list [[1,1],2,[1,1]], return 10. (four 1’s at depth 2, one 2 at depth 1)

215.1 Java Solution 1 - Recursive

public int depthSum(List<NestedInteger> nestedList) {


return helper(nestedList, 1);
}

public int helper(List<NestedInteger> nestedList, int depth){


if(nestedList==null||[Link]()==0)
return 0;

int sum=0;
for(NestedInteger ni: nestedList){
if([Link]()){
sum += [Link]() * depth;
}else{
sum += helper([Link](), depth+1);
}
}

return sum;
}

215.2 Java Solution 2 - Iterative

public int depthSum(List<NestedInteger> nestedList) {


int sum=0;

LinkedList<NestedInteger> queue = new LinkedList<NestedInteger>();


LinkedList<Integer> depth = new LinkedList<Integer>();

for(NestedInteger ni: nestedList){


[Link](ni);
[Link](1);
}

while(![Link]()){
NestedInteger top = [Link]();
int dep = [Link]();

if([Link]()){
sum += dep*[Link]();

417 | 568
215 Nested List Weight Sum

}else{
for(NestedInteger ni: [Link]()){
[Link](ni);
[Link](dep+1);
}
}
}

return sum;
}

Program Creek 418 | 568


216 Nested List Weight Sum II
Given a nested list of integers, return the sum of all integers in the list weighted by their depth.
Each element is either an integer, or a list – whose elements may also be integers or other lists.
Different from the previous question where weight is increasing from root to leaf, now the weight is defined
from bottom up. i.e., the leaf level integers have weight 1, and the root level integers have the largest weight.
Example 1: Given the list [[1,1],2,[1,1]], return 8. (four 1’s at depth 1, one 2 at depth 2)
Example 2: Given the list [1,[4,[6]]], return 17. (one 1 at depth 3, one 4 at depth 2, and one 6 at depth 1; 1*3 +
4*2 + 6*1 = 17)

216.1 Java Solution

public int depthSumInverse(List<NestedInteger> nestedList) {


if(nestedList==null||[Link]()==0)
return 0;

HashMap<Integer, ArrayList<Integer>> map = new HashMap<Integer, ArrayList<Integer>>();

//two stacks: one is for processing nested integer, the other is for tracking layers.
Stack<NestedInteger> stack = new Stack<NestedInteger>();
Stack<Integer> layers = new Stack<Integer>();

//put all NestedIntegers to Stack and record its layer to be 1


for(NestedInteger ni: nestedList){
[Link](ni);
[Link](1);
}

int maxLayer=Integer.MIN_VALUE;

while(![Link]()){
NestedInteger top = [Link]();
int topLayer = [Link]();

maxLayer=[Link](maxLayer, topLayer);

if([Link]()){
if([Link](topLayer)){
[Link](topLayer).add([Link]());
}else{
ArrayList<Integer> list = new ArrayList<Integer>();
[Link]([Link]());
[Link](topLayer, list);
}
}else{
for(NestedInteger ni: [Link]()){
[Link](ni);
[Link](topLayer+1);
}
}

419 | 568
216 Nested List Weight Sum II

// calcualte sum
int result=0;
for(int i=maxLayer; i>=1; i--){
if([Link](i)!=null){
for(int v: [Link](i)){
result += v*(maxLayer-i+1);
}
}
}

return result;
}

Program Creek 420 | 568


217 Decode String
Given an encoded string, return it’s decoded string.
The encoding rule is: k[encoded_string], where the encoded_string inside the square brackets is being repeated
exactly k times. Note that k is guaranteed to be a positive integer.
You may assume that the input string is always valid; No extra white spaces, square brackets are well-formed,
etc.
Furthermore, you may assume that the original data does not contain any digits and that digits are only for
those repeat numbers, k. For example, there won’t be input like 3a or 2[4].
Examples:

s = "3[a]2[bc]", return "aaabcbc".


s = "3[a2[c]]", return "accaccacc".
s = "2[abc]3[cd]ef", return "abcabccdcdcdef".

217.1 Java Solution


The key to solve this problem is convert the string to a structured data structure and recursively form the return
string.

class Node{
int num;
ArrayList<Node> list;
char symbol;
boolean isList;

public Node(char s){


symbol=s;
}

public Node(int n){


list = new ArrayList<Node>();
isList=true;
num=n;
}

public String toString(){


String s = "";
if(isList){
s += num + ":" + [Link]();
}else{
s += symbol;
}
return s;
}
}

public class Solution {


public String decodeString(String s) {
int i = 0;

421 | 568
217 Decode String

Stack<Node> stack = new Stack<Node>();

[Link](new Node(1));

String t = "";
while (i < [Link]()) {
char c = [Link](i);

// new Node
if (c >= ’0’ && c <= ’9’) {
t += c;

} else if (c == ’[’) {
if ([Link]() > 0) {
int num = [Link](t);
[Link](new Node(num));
t = "";
}
} else if (c == ’]’) {
Node top = [Link]();

if ([Link]()) {

} else {
[Link]().[Link](top);
}

} else {
[Link]().[Link](new Node(c));
}

i++;
}

return getString([Link]());
}

public String getString(Node node){


String s="";
if([Link]){
for(int i=0; i<[Link]; i++){
for(Node t: [Link])
s+= getString(t);
}
}else{
s+=[Link];
}

return s;
}
}

Program Creek 422 | 568


218 Evaluate math expression with plus, minus
and parentheses
Given a string of math expression, such as 1-(2+3), evaluate the value. The expression contains only digits, +, -
and parentheses.

218.1 Java Solution

import [Link];
import [Link];

public class ExpressionEvaluator {


static class Node {
Boolean isPositive;
Integer value;
ArrayList<Node> list;

public Node(boolean isPositive, Integer value) {


[Link] = isPositive;
[Link] = value;
[Link] = new ArrayList<>();
}

public int evaluate() {


int sum = 0;
for (Node t : list) {
if ([Link]) {
sum = sum + [Link];
} else {
sum = sum - [Link];
}
}
return sum;
}
}

public static int evaluate(String s) {


Stack<Node> stack = new Stack<>();
[Link](new Node(true, 0));

Boolean isPositive = true;


StringBuilder sb = null;

for (int i = 0; i < [Link](); i++) {


char c = [Link](i);
Node top = [Link]();

if (c >= ’0’ && c <= ’9’) {


if (sb == null) {

423 | 568
218 Evaluate math expression with plus, minus and parentheses

sb = new StringBuilder();
}
[Link](c);
if (i == [Link]() - 1
|| [Link](i + 1) < ’0’ || [Link](i + 1) > ’9’) {
[Link](new Node(
isPositive == null ? true : isPositive,
[Link]([Link]())));
isPositive = null;
sb = null;
}
} else if (c == ’(’) {
Node t = new Node(isPositive, null);
isPositive = null;
[Link](t);
[Link](t);
} else if (c == ’)’) {
int val = [Link]().evaluate();
top = [Link]();
[Link]([Link]() - 1).value = val;
} else if (c == ’-’ || c == ’+’) {
if (c == ’-’) {
isPositive = false;
} else {
isPositive = true;
}
}
}

return [Link]().evaluate();
}

public static void main(String[] args) {


[Link](evaluate("(1-20)+3")); //-16
[Link](evaluate("1-(20+1-(2+3))")); //-15
}
}

Program Creek 424 | 568


219 Partition to K Equal Sum Subsets
Given an array of integers nums and a positive integer k, find whether it’s possible to divide this array into k
non-empty subsets whose sums are all equal.
Example 1:
Input: nums = [4, 3, 2, 3, 5, 2, 1], k = 4 Output: True Explanation: It’s possible to divide it into 4 subsets (5), (1,
4), (2,3), (2,3) with equal sums.

219.1 Java Solution


The easiest solution to this problem is DFS. We try to place each element to one of the bucket. The following is a
Java solution and there is a diagram to show the execution of the helper() method using the given example. Note
the improvement in the for loop.

public boolean canPartitionKSubsets(int[] nums, int k) {


int sum = 0;
for(int num: nums){
sum+=num;
}
if(sum%k!=0){
return false;
}

int share = sum/k;

//sort array
[Link](nums);

int j=[Link]-1;
if(nums[j]>share){
return false;
}
while(j>=0 && nums[j]==share){
j--;
k--;
}

int[] buckets = new int[k];


return helper(j, nums, share, buckets);
}

//put jth number to each bucket and recursively search


public boolean helper(int j, int[] nums, int share, int[] buckets){
if(j<0){
return true;
}

for(int i=0; i<[Link]; i++){


if(buckets[i]+nums[j]<=share){
buckets[i]+=nums[j];
if(helper(j-1, nums, share, buckets)){

425 | 568
219 Partition to K Equal Sum Subsets

return true;
}
buckets[i]-=nums[j];
}

if(buckets[i]==0) break;//
}

return false;
}

Program Creek 426 | 568


220 Permutations
Given a collection of numbers, return all possible permutations.

For example,
[1,2,3] have the following permutations:
[1,2,3], [1,3,2], [2,1,3], [2,3,1], [3,1,2], and [3,2,1].

220.1 Java Solution 1 - Iteration


We can get all permutations by the following steps:

[1]
[2, 1]
[1, 2]
[3, 2, 1]
[2, 3, 1]
[2, 1, 3]
[3, 1, 2]
[1, 3, 2]
[1, 2, 3]

Loop through the array, in each iteration, a new number is added to different locations of results of previous
iteration. Start from an empty List.

public ArrayList<ArrayList<Integer>> permute(int[] num) {


ArrayList<ArrayList<Integer>> result = new ArrayList<ArrayList<Integer>>();

//start from an empty list


[Link](new ArrayList<Integer>());

for (int i = 0; i < [Link]; i++) {


//list of list in current iteration of the array num
ArrayList<ArrayList<Integer>> current = new ArrayList<ArrayList<Integer>>();

for (ArrayList<Integer> l : result) {


// # of locations to insert is largest index + 1
for (int j = 0; j < [Link]()+1; j++) {
// + add num[i] to different locations
[Link](j, num[i]);

ArrayList<Integer> temp = new ArrayList<Integer>(l);


[Link](temp);

//[Link](temp);

// - remove num[i] add


[Link](j);
}
}

427 | 568
220 Permutations

result = new ArrayList<ArrayList<Integer>>(current);


}

return result;
}

220.2 Java Solution 2 - Recursion


We can also recursively solve this problem. Swap each element with each element after it.

public List<List<Integer>> permute(int[] nums) {


List<List<Integer>> result = new ArrayList<>();
helper(0, nums, result);
return result;
}

private void helper(int start, int[] nums, List<List<Integer>> result){


if(start==[Link]-1){
ArrayList<Integer> list = new ArrayList<>();
for(int num: nums){
[Link](num);
}
[Link](list);
return;
}

for(int i=start; i<[Link]; i++){


swap(nums, i, start);
helper(start+1, nums, result);
swap(nums, i, start);
}
}

private void swap(int[] nums, int i, int j){


int temp = nums[i];
nums[i] = nums[j];
nums[j] = temp;
}

Program Creek 428 | 568


220 Permutations

Since C(n)=1+C(n-1), if we expand it, we can get time complexity is O(N!).

Program Creek 429 | 568


221 Permutations II
Given a collection of numbers that might contain duplicates, return all possible unique permutations.

For example, [1,1,2] have the following unique permutations:


[1,1,2], [1,2,1], and [2,1,1].

221.1 Java Solution 1


Based on Permutation, we can add a set to track if an element is duplicate and no need to swap.

public List<List<Integer>> permuteUnique(int[] nums) {


List<List<Integer>> result = new ArrayList<>();
helper(0, nums, result);
return result;
}

private void helper(int start, int[] nums, List<List<Integer>> result){


if(start==[Link]-1){
ArrayList<Integer> list = new ArrayList<>();
for(int num: nums){
[Link](num);
}
[Link](list);
return;
}

HashSet<Integer> set = new HashSet<>();

for(int i=start; i<[Link]; i++){


if([Link](nums[i])){
continue;
}
[Link](nums[i]);

swap(nums, i, start);
helper(start+1, nums, result);
swap(nums, i, start);
}
}

private void swap(int[] nums, int i, int j){


int temp = nums[i];
nums[i] = nums[j];
nums[j] = temp;
}

430 | 568
221 Permutations II

221.2 Java Solution 2


Use set to maintain uniqueness:

public static ArrayList<ArrayList<Integer>> permuteUnique(int[] num) {


ArrayList<ArrayList<Integer>> returnList = new ArrayList<ArrayList<Integer>>();
[Link](new ArrayList<Integer>());

for (int i = 0; i < [Link]; i++) {


Set<ArrayList<Integer>> currentSet = new HashSet<ArrayList<Integer>>();
for (List<Integer> l : returnList) {
for (int j = 0; j < [Link]() + 1; j++) {
[Link](j, num[i]);
ArrayList<Integer> T = new ArrayList<Integer>(l);
[Link](j);
[Link](T);
}
}
returnList = new ArrayList<ArrayList<Integer>>(currentSet);
}

return returnList;
}

Thanks to Milan for such a simple solution!

Program Creek 431 | 568


222 Permutation Sequence
The set [1,2,3,. . . ,n] contains a total of n! unique permutations.
By listing and labeling all of the permutations in order, We get the following sequence (ie, for n = 3):

"123"
"132"
"213"
"231"
"312"
"321"

Given n and k, return the kth permutation sequence. (Note: Given n will be between 1 and 9 inclusive.)

222.1 Java Solution 1

public class Solution {


public String getPermutation(int n, int k) {

// initialize all numbers


ArrayList<Integer> numberList = new ArrayList<Integer>();
for (int i = 1; i <= n; i++) {
[Link](i);
}

// change k to be index
k--;

// set factorial of n
int mod = 1;
for (int i = 1; i <= n; i++) {
mod = mod * i;
}

String result = "";

// find sequence
for (int i = 0; i < n; i++) {
mod = mod / (n - i);
// find the right number(curIndex) of
int curIndex = k / mod;
// update k
k = k % mod;

// get number according to curIndex


result += [Link](curIndex);
// remove from list
[Link](curIndex);
}

432 | 568
222 Permutation Sequence

return [Link]();
}
}

222.2 Java Solution 2

public class Solution {


public String getPermutation(int n, int k) {
boolean[] output = new boolean[n];
StringBuilder buf = new StringBuilder("");

int[] res = new int[n];


res[0] = 1;

for (int i = 1; i < n; i++)


res[i] = res[i - 1] * i;

for (int i = n - 1; i >= 0; i--) {


int s = 1;

while (k > res[i]) {


s++;
k = k - res[i];
}

for (int j = 0; j < n; j++) {


if (j + 1 <= s && output[j]) {
s++;
}
}

output[s - 1] = true;
[Link]([Link](s));
}

return [Link]();
}
}

Program Creek 433 | 568


223 Number of Squareful Arrays
Given an array A of non-negative integers, the array is squareful if for every pair of adjacent elements, their sum
is a perfect square.
Return the number of permutations of A that are squareful. Two permutations A1 and A2 differ if and only if
there is some index i such that A1[i] != A2[i].
Example 1:
Input: [1,17,8] Output: 2 Explanation: [1,8,17] and [17,8,1] are the valid permutations.
Example 2:
Input: [2,2,2] Output: 1

223.1 Java Solution


This problem can be solved by using the similar method of Permutation II. A set can be used to track if same
element is swapped. The major difference is that we need to check if previous adjacent two neighbors are
squareful.

434 | 568
223 Number of Squareful Arrays

class Solution {
int count = 0;

public int numSquarefulPerms(int[] A) {


[Link](A);
helper(A, 0);
return count;
}

void helper(int[] A, int start){


//the adjacent two numbers before start
if(start>1 && (!isSquareful(A[start], A[start-1]) || !isSquareful(A[start-1], A[start-2]))){
return;
}
//if start is the last, then check start with its adjancent neighbor
if(start==[Link]-1 && !isSquareful(A[start], A[start-1])){
return;
}

Program Creek 435 | 568


223 Number of Squareful Arrays

if(start==[Link]-1){
count++;
return;
}

HashSet<Integer> set = new HashSet<>();


for(int i=start; i<[Link]; i++){
//use set to track if the same element is used
if([Link](A[i])){
continue;
}
[Link](A[i]);

swap(A, i, start);
helper(A, start+1);
swap(A, i, start);
}
}

void swap(int[] A, int i, int j){


int t = A[i];
A[i] = A[j];
A[j] = t;
}

boolean isSquareful(int a, int b){


double root = [Link](a+b);
return ([Link](root))==0;
}
}

Program Creek 436 | 568


224 Generate Parentheses
Given n pairs of parentheses, write a function to generate all combinations of well-formed parentheses.
For example, given n = 3, a solution set is:

"((()))", "(()())", "(())()", "()(())", "()()()"

224.1 Java Solution 1 - DFS


This solution is simple and clear. In the dfs() method, left stands for the remaining number of (, right stands for
the remaining number of ).

public List<String> generateParenthesis(int n) {


ArrayList<String> result = new ArrayList<String>();
dfs(result, "", n, n);
return result;
}
/*
left and right represents the remaining number of ( and ) that need to be added.
When left > right, there are more ")" placed than "(". Such cases are wrong and the method stops.
*/
public void dfs(ArrayList<String> result, String s, int left, int right){
if(left > right)
return;

if(left==0&&right==0){
[Link](s);
return;
}

if(left>0){
dfs(result, s+"(", left-1, right);
}

if(right>0){
dfs(result, s+")", left, right-1);
}
}

224.2 Java Solution 2


This solution looks more complicated. ,You can use n=2 to walk though the code.

public List<String> generateParenthesis(int n) {


ArrayList<String> result = new ArrayList<String>();
ArrayList<Integer> diff = new ArrayList<Integer>();

[Link]("");

437 | 568
224 Generate Parentheses

[Link](0);

for (int i = 0; i < 2 * n; i++) {


ArrayList<String> temp1 = new ArrayList<String>();
ArrayList<Integer> temp2 = new ArrayList<Integer>();

for (int j = 0; j < [Link](); j++) {


String s = [Link](j);
int k = [Link](j);

if (i < 2 * n - 1) {
[Link](s + "(");
[Link](k + 1);
}

if (k > 0 && i < 2 * n - 1 || k == 1 && i == 2 * n - 1) {


[Link](s + ")");
[Link](k - 1);
}
}

result = new ArrayList<String>(temp1);


diff = new ArrayList<Integer>(temp2);
}

return result;
}

Program Creek 438 | 568


225 Combination Sum
Given a set of candidate numbers (C) and a target number (T), find all unique combinations in C where the
candidate numbers sums to T. The same repeated number may be chosen from C unlimited number of times.
Note: All numbers (including target) will be positive integers. Elements in a combination (a1, a2, ... , ak) must
be in non-descending order. (ie, a1 <= a2 <= ... <= ak). The solution set must not contain duplicate combinations.
For example, given candidate set 2,3,6,7 and target 7, A solution set is:

[7]
[2, 2, 3]

225.1 Java Solution


The first impression of this problem should be depth-first search(DFS). To solve DFS problem, recursion is a
normal implementation.
The following example shows how DFS works:

public List<List<Integer>> combinationSum(int[] candidates, int target) {


List<List<Integer>> result = new ArrayList<>();
List<Integer> temp = new ArrayList<>();
helper(candidates, 0, target, 0, temp, result);
return result;
}

private void helper(int[] candidates, int start, int target, int sum,

439 | 568
225 Combination Sum

List<Integer> list, List<List<Integer>> result){


if(sum>target){
return;
}

if(sum==target){
[Link](new ArrayList<>(list));
return;
}

for(int i=start; i<[Link]; i++){


[Link](candidates[i]);
helper(candidates, i, target, sum+candidates[i], list, result);
[Link]([Link]()-1);
}
}

Program Creek 440 | 568


226 Combination Sum II
Given a collection of candidate numbers (C) and a target number (T), find all unique combinations in C where
the candidate numbers sums to T. Each number in C may only be used ONCE in the combination.
Note: 1) All numbers (including target) will be positive integers. 2) Elements in a combination (a1, a2, . . . ,
ak) must be in non-descending order. (ie, a1 ≤ a2 ≤ . . . ≤ ak). 3) The solution set must not contain duplicate
combinations.

226.1 Java Solution


This problem is an extension of Combination Sum. The difference is one number in the array can only be used
ONCE.

public List<List<Integer>> combinationSum2(int[] candidates, int target) {


List<List<Integer>> result = new ArrayList<List<Integer>>();
List<Integer> curr = new ArrayList<Integer>();
[Link](candidates);
helper(result, curr, 0, target, candidates);
return result;
}

public void helper(List<List<Integer>> result, List<Integer> curr, int start, int target, int[]
candidates){
if(target==0){
[Link](new ArrayList<Integer>(curr));
return;
}
if(target<0){
return;
}

int prev=-1;
for(int i=start; i<[Link]; i++){
if(prev!=candidates[i]){ // each time start from different element
[Link](candidates[i]);
helper(result, curr, i+1, target-candidates[i], candidates); // and use next element only
[Link]([Link]()-1);
prev=candidates[i];
}
}
}

441 | 568
227 Combination Sum III
Find all possible combinations of k numbers that add up to a number n, given that only numbers from 1 to 9 can
be used and each combination should be a unique set of numbers.
Ensure that numbers within the set are sorted in ascending order.
Example 1: Input: k = 3, n = 7 Output: [[1,2,4]] Example 2: Input: k = 3, n = 9 Output: [[1,2,6], [1,3,5], [2,3,4]]

227.1 Analysis
Related problems: Combination Sum, Combination Sum II.

227.2 Java Solution

public List<List<Integer>> combinationSum3(int k, int n) {


List<List<Integer>> result = new ArrayList<List<Integer>>();
List<Integer> curr = new ArrayList<Integer>();
helper(result, curr, k, 1, n);
return result;
}

public void helper(List<List<Integer>> result, List<Integer> curr, int k, int start, int sum){
if(sum<0){
return;
}

if(sum==0 && [Link]()==k){


[Link](new ArrayList<Integer>(curr));
return;
}

for(int i=start; i<=9; i++){


[Link](i);
helper(result, curr, k, i+1, sum-i);
[Link]([Link]()-1);
}
}

442 | 568
228 Combination Sum IV
Given an integer array with all positive numbers and no duplicates, find the number of possible combinations
that add up to a positive integer target.

228.1 Java Solution


This problem is similar to Coin Change. It’s a typical dynamic programming problem.

public int combinationSum4(int[] nums, int target) {


if(nums==null || [Link]==0)
return 0;

int[] dp = new int[target+1];

dp[0]=1;

for(int i=0; i<=target; i++){


for(int num: nums){
if(i+num<=target){
dp[i+num]+=dp[i];
}
}
}

return dp[target];
}

443 | 568
229 Wildcard Matching
Implement wildcard pattern matching with support for ’?’ and ’*’.

229.1 Java Solution


To understand this solution, you can use s="aab" and p="*ab".

public boolean isMatch(String s, String p) {


int i = 0;
int j = 0;
int starIndex = -1;
int iIndex = -1;

while (i < [Link]()) {


if (j < [Link]() && ([Link](j) == ’?’ || [Link](j) == [Link](i))) {
++i;
++j;
} else if (j < [Link]() && [Link](j) == ’*’) {
starIndex = j;
iIndex = i;
j++;
} else if (starIndex != -1) {
j = starIndex + 1;
i = iIndex+1;
iIndex++;
} else {
return false;
}
}

while (j < [Link]() && [Link](j) == ’*’) {


++j;
}

return j == [Link]();
}

444 | 568
230 Regular Expression Matching
Implement regular expression matching with support for ’.’ and ’*’.
’.’ Matches any single character. ’*’ Matches zero or more of the preceding element.
The matching should cover the entire input string (not partial).
The function prototype should be: bool isMatch(const char *s, const char *p)
Some examples: isMatch("aa","a") return false isMatch("aa","aa") return true isMatch("aaa","aa") return false
isMatch("aa", "a*") return true isMatch("aa", ".*") return true isMatch("ab", ".*") return true isMatch("aab", "c*a*b")
return true

230.1 Analysis
First of all, this is one of the most difficulty problems. It is hard to think through all different cases. The problem
should be simplified to handle 2 basic cases:

• the second char of pattern is "*"


• the second char of pattern is not "*"

For the 1st case, if the first char of pattern is not ".", the first char of pattern and string should be the same.
Then continue to match the remaining part.
For the 2nd case, if the first char of pattern is "." or first char of pattern == the first i char of string, continue to
match the remaining part.

230.2 Java Solution 1 (Short)


The following Java solution is accepted.

public class Solution {


public boolean isMatch(String s, String p) {

if([Link]() == 0)
return [Link]() == 0;

//p’s length 1 is special case


if([Link]() == 1 || [Link](1) != ’*’){
if([Link]() < 1 || ([Link](0) != ’.’ && [Link](0) != [Link](0)))
return false;
return isMatch([Link](1), [Link](1));

}else{
int len = [Link]();

int i = -1;
while(i<len && (i < 0 || [Link](0) == ’.’ || [Link](0) == [Link](i))){
if(isMatch([Link](i+1), [Link](2)))
return true;
i++;
}
return false;

445 | 568
230 Regular Expression Matching

}
}
}

230.3 Java Solution 2 (More Readable)

public boolean isMatch(String s, String p) {


// base case
if ([Link]() == 0) {
return [Link]() == 0;
}

// special case
if ([Link]() == 1) {

// if the length of s is 0, return false


if ([Link]() < 1) {
return false;
}

//if the first does not match, return false


else if (([Link](0) != [Link](0)) && ([Link](0) != ’.’)) {
return false;
}

// otherwise, compare the rest of the string of s and p.


else {
return isMatch([Link](1), [Link](1));
}
}

// case 1: when the second char of p is not ’*’


if ([Link](1) != ’*’) {
if ([Link]() < 1) {
return false;
}
if (([Link](0) != [Link](0)) && ([Link](0) != ’.’)) {
return false;
} else {
return isMatch([Link](1), [Link](1));
}
}

// case 2: when the second char of p is ’*’, complex case.


else {
//case 2.1: a char & ’*’ can stand for 0 element
if (isMatch(s, [Link](2))) {
return true;
}

//case 2.2: a char & ’*’ can stand for 1 or more preceding element,
//so try every sub string
int i = 0;
while (i<[Link]() && ([Link](i)==[Link](0) || [Link](0)==’.’)){
if (isMatch([Link](i + 1), [Link](2))) {

Program Creek 446 | 568


230 Regular Expression Matching

return true;
}
i++;
}
return false;
}
}

Program Creek 447 | 568


231 Expressive Words
Sometimes people repeat letters to represent extra feeling, such as "hello" ->"heeellooo", "hi" ->"hiiii". In these
strings like "heeellooo", we have groups of adjacent letters that are all the same: "h", "eee", "ll", "ooo".
For some given string S, a query word is stretchy if it can be made to be equal to S by any number of applica-
tions of the following extension operation: choose a group consisting of characters c, and add some number of
characters c to the group so that the size of the group is 3 or more.
For example, starting with "hello", we could do an extension on the group "o" to get "hellooo", but we cannot
get "helloo" since the group "oo" has size less than 3. Also, we could do another extension like "ll" ->"lllll" to
get "helllllooo". If S = "helllllooo", then the query word "hello" would be stretchy because of these two extension
operations: query = "hello" ->"hellooo" ->"helllllooo" = S.
Given a list of query words, return the number of words that are stretchy.
Example: Input: S = "heeellooo" words = ["hello", "hi", "helo"] Output: 1 Explanation: We can extend "e" and
"o" in the word "hello" to get "heeellooo". We can’t extend "helo" to get "heeellooo" because the group "ll" is not
size 3 or more.

231.1 Java Solution


This problem is similar to regular expression matching.

public int expressiveWords(String S, String[] words) {


int count = 0;
for (String s : words) {
if (isMatch(S, 0, s, 0)) {
count++;
}
}

return count;
}

private boolean isMatch(String s1, int i, String s2, int j) {


if (i >= [Link]() && j >= [Link]()) {
return true;
} else if (i >= [Link]() || j >= [Link]()) {
return false;
}

if ([Link](i) != [Link](j)) {
return false;
}

boolean res = false;

if (i + 2 < [Link]()
&& [Link](i + 1) == [Link](j)
&& [Link](i + 2) == [Link](j)) {
int m = i + 2;
int n = j + 1;
while (m < [Link]() && [Link](m) == [Link](j)) {

448 | 568
231 Expressive Words

m++;
}
while (n < [Link]() && [Link](n) == [Link](n - 1)) {
n++;
}
if (n - j > m - i) {
return false;
}

res = isMatch(s1, m, s2, n);


}

res = res | isMatch(s1, i + 1, s2, j + 1);

return res;
}

Program Creek 449 | 568


232 Get Target Number Using Number List and
Arithmetic Operations
Given a list of numbers and a target number, write a program to determine whether the target number can be
calculated by applying "+-*/" operations to the number list? You can assume () is automatically added when
necessary.
For example, given 1,2,3,4 and 21, return true. Because (1+2)*(3+4)=21

232.1 Analysis
This is a partition problem which can be solved by using depth first search.

232.2 Java Solution

public static boolean isReachable(ArrayList<Integer> list, int target) {


if (list == null || [Link]() == 0)
return false;

int i = 0;
int j = [Link]() - 1;

ArrayList<Integer> results = getResults(list, i, j, target);

for (int num : results) {


if (num == target) {
return true;
}
}

return false;
}

public static ArrayList<Integer> getResults(ArrayList<Integer> list,


int left, int right, int target) {
ArrayList<Integer> result = new ArrayList<Integer>();

if (left > right) {


return result;
} else if (left == right) {
[Link]([Link](left));
return result;
}

for (int i = left; i < right; i++) {

ArrayList<Integer> result1 = getResults(list, left, i, target);


ArrayList<Integer> result2 = getResults(list, i + 1, right, target);

450 | 568
232 Get Target Number Using Number List and Arithmetic Operations

for (int x : result1) {


for (int y : result2) {
[Link](x + y);
[Link](x - y);
[Link](x * y);
if (y != 0)
[Link](x / y);
}
}
}

return result;
}

Program Creek 451 | 568


233 Flip Game
You are playing the following Flip Game with your friend: Given a string that contains only these two characters:
+ and -, you and your friend take turns to flip two consecutive "++" into "–". The game ends when a person can
no longer make a move and therefore the other person will be the winner.
Write a function to compute all possible states of the string after one valid move.

233.1 Java Solution

public List<String> generatePossibleNextMoves(String s) {


List<String> result = new ArrayList<String>();

if(s==null)
return result;

char[] arr = [Link]();


for(int i=0; i<[Link]-1; i++){
if(arr[i]==arr[i+1] && arr[i]==’+’){
arr[i]=’-’;
arr[i+1]=’-’;
[Link](new String(arr));
arr[i]=’+’;
arr[i+1]=’+’;
}
}

return result;
}

452 | 568
234 Flip Game II
You are playing the following Flip Game with your friend: Given a string that contains only these two characters:
+ and -, you and your friend take turns to flip two consecutive "++" into "–". The game ends when a person can
no longer make a move and therefore the other person will be the winner.
Write a function to determine if the starting player can guarantee a win.
For example, given s = "++++", return true. The starting player can guarantee a win by flipping the middle
"++" to become "+–+".

234.1 Java Solution


This problem is solved by backtracking.

public boolean canWin(String s) {


if(s==null||[Link]()==0){
return false;
}

return canWinHelper([Link]());
}

public boolean canWinHelper(char[] arr){


for(int i=0; i<[Link]-1;i++){
if(arr[i]==’+’&&arr[i+1]==’+’){
arr[i]=’-’;
arr[i+1]=’-’;

boolean win = canWinHelper(arr);

arr[i]=’+’;
arr[i+1]=’+’;

//if there is a flip which makes the other player lose, the first play wins
if(!win){
return true;
}
}
}

return false;
}

234.2 Time Complexity


Roughly, the time is n*n*...n, which is O(nn̂). The reason is each recursion takes O(n) and there are totally n
recursions.

453 | 568
235 Word Pattern
Given a pattern and a string str, find if str follows the same pattern. Here follow means a full match, such that
there is a bijection between a letter in pattern and a non-empty word in str.

235.1 Java Solution

public boolean wordPattern(String pattern, String str) {


String[] arr = [Link](" ");

//prevent out of boundary problem


if([Link] != [Link]())
return false;

HashMap<Character, String> map = new HashMap<Character, String>();


for(int i=0; i<[Link](); i++){
char c = [Link](i);
if([Link](c)){
String value = [Link](c);
if(![Link](arr[i])){
return false;
}
}else if ([Link](arr[i])){
return false;
}
[Link](c, arr[i]);
}

return true;
}

454 | 568
236 Word Pattern II
This is the extension problem of Word Pattern I.
Given a pattern and a string str, find if str follows the same pattern.
Here follow means a full match, such that there is a bijection between a letter in pattern and a non-empty
substring in str.
Examples: pattern = "abab", str = "redblueredblue" should return true. pattern = "aaaa", str = "asdasdasdasd"
should return true. pattern = "aabb", str = "xyzabcxzyabc" should return false.

236.1 Java Solution

public boolean wordPatternMatch(String pattern, String str) {


if([Link]()==0 && [Link]()==0)
return true;
if([Link]()==0)
return false;

HashMap<Character, String> map = new HashMap<Character, String>();

return helper(pattern, str, 0, 0, map);


}

public boolean helper(String pattern, String str, int i, int j, HashMap<Character, String> map){
if(i==[Link]() && j==[Link]()){
return true;
}

if(i>=[Link]() || j>=[Link]())
return false;

char c = [Link](i);
for(int k=j+1; k<=[Link](); k++){
String sub = [Link](j, k);
if(![Link](c) && ![Link](sub)){
[Link](c, sub);
if(helper(pattern, str, i+1, k, map))
return true;
[Link](c);
}else if([Link](c) && [Link](c).equals(sub)){
if(helper(pattern, str, i+1, k, map))
return true;
}
}

return false;
}

Since containsValue() method is used here, the time complexity is O(n). We can use another set to track the
value set which leads to time complexity of O(1):

455 | 568
236 Word Pattern II

public boolean wordPatternMatch(String pattern, String str) {


if([Link]()==0 && [Link]()==0)
return true;
if([Link]()==0)
return false;

HashMap<Character, String> map = new HashMap<Character, String>();


HashSet<String> set = new HashSet<String>();
return helper(pattern, str, 0, 0, map, set);
}

public boolean helper(String pattern, String str, int i, int j, HashMap<Character, String> map,
HashSet<String> set){
if(i==[Link]() && j==[Link]()){
return true;
}

if(i>=[Link]() || j>=[Link]())
return false;

char c = [Link](i);
for(int k=j+1; k<=[Link](); k++){
String sub = [Link](j, k);
if(![Link](c) && ![Link](sub)){
[Link](c, sub);
[Link](sub);
if(helper(pattern, str, i+1, k, map, set))
return true;
[Link](c);
[Link](sub);
}else if([Link](c) && [Link](c).equals(sub)){
if(helper(pattern, str, i+1, k, map, set))
return true;
}
}

return false;
}

The time complexity then is f(n) = n*(n-1)*... *1=nn̂.

Program Creek 456 | 568


237 Scramble String
Given two strings s1 and s2 of the same length, determine if s2 is a scrambled string of s1.

237.1 Java Solution

public boolean isScramble(String s1, String s2) {


if([Link]()!=[Link]())
return false;

if([Link]()==0 || [Link](s2))
return true;

char[] arr1 = [Link]();


char[] arr2 = [Link]();
[Link](arr1);
[Link](arr2);
if(!new String(arr1).equals(new String(arr2))){
return false;
}

for(int i=1; i<[Link](); i++){


String s11 = [Link](0, i);
String s12 = [Link](i, [Link]());
String s21 = [Link](0, i);
String s22 = [Link](i, [Link]());
String s23 = [Link](0, [Link]()-i);
String s24 = [Link]([Link]()-i, [Link]());

if(isScramble(s11, s21) && isScramble(s12, s22))


return true;
if(isScramble(s11, s24) && isScramble(s12, s23))
return true;
}

return false;
}

457 | 568
238 Remove Invalid Parentheses
Remove the minimum number of invalid parentheses in order to make the input string valid. Return all possible
results.
Note: The input string may contain letters other than the parentheses ( and ).
Examples: "()())()" ->["()()()", "(())()"] "(a)())()" ->["(a)()()", "(a())()"] ")(" ->[""]

238.1 Java Solution


This problem can be solve by using DFS.

public class Solution {


ArrayList<String> result = new ArrayList<String>();
int max=0;

public List<String> removeInvalidParentheses(String s) {


if(s==null)
return result;

dfs(s, "", 0, 0);


if([Link]()==0){
[Link]("");
}

return result;
}

public void dfs(String left, String right, int countLeft, int maxLeft){
if([Link]()==0){
if(countLeft==0 && [Link]()!=0){
if(maxLeft > max){
max = maxLeft;
}

if(maxLeft==max && ![Link](right)){


[Link](right);
}
}

return;
}

if([Link](0)==’(’){
dfs([Link](1), right+"(", countLeft+1, maxLeft+1);//keep (
dfs([Link](1), right, countLeft, maxLeft);//drop (
}else if([Link](0)==’)’){
if(countLeft>0){
dfs([Link](1), right+")", countLeft-1, maxLeft);
}

dfs([Link](1), right, countLeft, maxLeft);

458 | 568
238 Remove Invalid Parentheses

}else{
dfs([Link](1), right+[Link]([Link](0)), countLeft, maxLeft);
}
}
}

Program Creek 459 | 568


239 Shortest Palindrome
Given a string S, you are allowed to convert it to a palindrome by adding characters in front of it. Find and return
the shortest palindrome you can find by performing this transformation.
For example, given "aacecaaa", return "aaacecaaa"; given "abcd", return "dcbabcd".

239.1 Java Solution 1

public String shortestPalindrome(String s) {


int i=0;
int j=[Link]()-1;

while(j>=0){
if([Link](i)==[Link](j)){
i++;
}
j--;
}

if(i==[Link]())
return s;

String suffix = [Link](i);


String prefix = new StringBuilder(suffix).reverse().toString();
String mid = shortestPalindrome([Link](0, i));
return prefix+mid+suffix;
}

239.2 Java Solution 2


We can solve this problem by using one of the methods which is used to solve the longest palindrome substring
problem.
Specifically, we can start from the center and scan two sides. If read the left boundary, then the shortest
palindrome is identified.

public String shortestPalindrome(String s) {


if (s == null || [Link]() <= 1)
return s;

String result = null;

int len = [Link]();


int mid = len / 2;

for (int i = mid; i >= 1; i--) {


if ([Link](i) == [Link](i - 1)) {
if ((result = scanFromCenter(s, i - 1, i)) != null)
return result;

460 | 568
239 Shortest Palindrome

} else {
if ((result = scanFromCenter(s, i - 1, i - 1)) != null)
return result;
}
}

return result;
}

private String scanFromCenter(String s, int l, int r) {


int i = 1;

//scan from center to both sides


for (; l - i >= 0; i++) {
if ([Link](l - i) != [Link](r + i))
break;
}

//if not end at the beginning of s, return null


if (l - i >= 0)
return null;

StringBuilder sb = new StringBuilder([Link](r + i));


[Link]();

return [Link](s).toString();
}

Program Creek 461 | 568


240 Lexicographical Numbers
Given an integer n, return 1 - n in lexicographical order.
For example, given 13, return: [1,10,11,12,13,2,3,4,5,6,7,8,9].
Please optimize your algorithm to use less time and space. The input size may be as large as 5,000,000.

240.1 Java Solution - DFS

public List<Integer> lexicalOrder(int n) {


int c=0;
int t=n;
while(t>0){
c++;
t=t/10;
}

ArrayList<Integer> result = new ArrayList<Integer>();


char[] num = new char[c];

helper(num, 0, n, result);

return result;
}

public void helper(char[] num, int i, int max, ArrayList<Integer> result){


if(i==[Link]){
int val = convert(num);
if(val <=max)
[Link](val);
return;
}

if(i==0){
for(char c=’1’; c<=’9’; c++){
num[i]=c;
helper(num, i+1, max, result);
}
}else{
num[i]=’a’;
helper(num, [Link], max, result);

for(char c=’0’; c<=’9’; c++){


num[i]=c;
helper(num, i+1, max, result);
}
}

private int convert(char[] arr){

462 | 568
240 Lexicographical Numbers

int result=0;
for(int i=0; i<[Link]; i++){
if(arr[i]>=’0’&&arr[i]<=’9’)
result = result*10+arr[i]-’0’;
else
break;
}
return result;
}

240.2 Java Solution 2 - Comparator

public List<Integer> lexicalOrder(int n) {


List<String> list = new ArrayList<>();
for(int i=1;i<=n;i++){
[Link]([Link](i));
}

[Link](list, new Comparator<String>(){


public int compare(String a, String b){
int i=0;
while(i<[Link]()&&i<[Link]()){
if([Link](i)!=[Link](i)){
return [Link](i)-[Link](i);
}
i++;
}

if(i>=[Link]()){
return -1;
}

return 1;
}
});

List<Integer> result = new ArrayList<>();


for(String s: list){
[Link]([Link](s));
}

return result;
}

Program Creek 463 | 568


241 Combinations
Given two integers n and k, return all possible combinations of k numbers out of 1 ... n.
For example, if n = 4 and k = 2, a solution is:

[
[2,4],
[3,4],
[2,3],
[1,2],
[1,3],
[1,4],
]

241.1 Java Solution

public ArrayList<ArrayList<Integer>> combine(int n, int k) {


ArrayList<ArrayList<Integer>> result = new ArrayList<ArrayList<Integer>>();

if (n <= 0 || n < k)
return result;

ArrayList<Integer> item = new ArrayList<Integer>();


dfs(n, k, 1, item, result); // because it need to begin from 1

return result;
}

private void dfs(int n, int k, int start, ArrayList<Integer> item,


ArrayList<ArrayList<Integer>> res) {
if ([Link]() == k) {
[Link](new ArrayList<Integer>(item));
return;
}

for (int i = start; i <= n; i++) {


[Link](i);
dfs(n, k, i + 1, item, res);
[Link]([Link]() - 1);
}
}

464 | 568
242 Letter Combinations of a Phone Number
Given a digit string, return all possible letter combinations that the number could represent. (Check out your
cellphone to see the mappings) Input:Digit string "23", Output: ["ad", "ae", "af", "bd", "be", "bf", "cd", "ce", "cf"].

242.1 Java Solution 1 - DFS


This problem can be solves by a typical DFS algorithm. DFS problems are very similar and can be solved by using
a simple recursion.

public List<String> letterCombinations(String digits) {


HashMap<Character, char[]> dict = new HashMap<Character, char[]>();
[Link](’2’,new char[]{’a’,’b’,’c’});
[Link](’3’,new char[]{’d’,’e’,’f’});
[Link](’4’,new char[]{’g’,’h’,’i’});
[Link](’5’,new char[]{’j’,’k’,’l’});
[Link](’6’,new char[]{’m’,’n’,’o’});
[Link](’7’,new char[]{’p’,’q’,’r’,’s’});
[Link](’8’,new char[]{’t’,’u’,’v’});
[Link](’9’,new char[]{’w’,’x’,’y’,’z’});

List<String> result = new ArrayList<String>();


if(digits==null||[Link]()==0){
return result;
}

char[] arr = new char[[Link]()];


helper(digits, 0, dict, result, arr);

return result;
}

private void helper(String digits, int index, HashMap<Character, char[]> dict,


List<String> result, char[] arr){
if(index==[Link]()){
[Link](new String(arr));
return;
}

char number = [Link](index);


char[] candidates = [Link](number);
for(int i=0; i<[Link]; i++){
arr[index]=candidates[i];
helper(digits, index+1, dict, result, arr);
}
}

Time complexity is O(kn̂), where k is the biggest number of letters a digit can map (k=4) and n is the length of
the digit string.

465 | 568
242 Letter Combinations of a Phone Number

242.2 Java Solution 2 - BFS

public List<String> letterCombinations(String digits) {


HashMap<Character, String> map = new HashMap<>();
[Link](’2’, "abc");
[Link](’3’, "def");
[Link](’4’, "ghi");
[Link](’5’, "jkl");
[Link](’6’, "mno");
[Link](’7’, "pqrs");
[Link](’8’, "tuv");
[Link](’9’, "wxyz");

List<String> l = new ArrayList<>();


if (digits == null || [Link]() == 0) {
return l;
}

[Link]("");

for (int i = 0; i < [Link](); i++) {


ArrayList<String> temp = new ArrayList<>();
String option = [Link]([Link](i));

for (int j = 0; j < [Link](); j++) {


for (int p = 0; p < [Link](); p++) {
[Link](new StringBuilder([Link](j)).append([Link](p)).toString());
}
}

[Link]();
[Link](temp);
}

return l;
}

Program Creek 466 | 568


243 Restore IP Addresses
Given a string containing only digits, restore it by returning all possible valid IP address combinations.
For example: given "25525511135",return ["[Link]", "[Link]"].

243.1 Java Solution


This is a typical search problem and it can be solved by using DFS.

public List<String> restoreIpAddresses(String s) {


ArrayList<ArrayList<String>> result = new ArrayList<ArrayList<String>>();
ArrayList<String> t = new ArrayList<String>();
dfs(result, s, 0, t);

ArrayList<String> finalResult = new ArrayList<String>();

for(ArrayList<String> l: result){
StringBuilder sb = new StringBuilder();
for(String str: l){
[Link](str+".");
}
[Link]([Link]() - 1);
[Link]([Link]());
}

return finalResult;
}

public void dfs(ArrayList<ArrayList<String>> result, String s, int start, ArrayList<String> t){


//if already get 4 numbers, but s is not consumed, return
if([Link]()>=4 && start!=[Link]())
return;

//make sure t’s size + remaining string’s length >=4


if(([Link]()+[Link]()-start+1)<4)
return;

//t’s size is 4 and no remaining part that is not consumed.


if([Link]()==4 && start==[Link]()){
ArrayList<String> temp = new ArrayList<String>(t);
[Link](temp);
return;
}

for(int i=1; i<=3; i++){


//make sure the index is within the boundary
if(start+i>[Link]())
break;

String sub = [Link](start, start+i);


//handle case like 001. i.e., if length > 1 and first char is 0, ignore the case.

467 | 568
243 Restore IP Addresses

if(i>1 && [Link](start)==’0’){


break;
}

//make sure each number <= 255


if([Link](sub)>255)
break;

[Link](sub);
dfs(result, s, start+i, t);
[Link]([Link]()-1);
}
}

Program Creek 468 | 568


244 Factor Combinations
Numbers can be regarded as product of its factors. For example,

8 = 2 x 2 x 2;
= 2 x 4.

Write a function that takes an integer n and return all possible combinations of its factors.
Note: You may assume that n is always positive. Factors should be greater than 1 and less than n.

244.1 Java Solution

public List<List<Integer>> getFactors(int n) {


List<List<Integer>> result = new ArrayList<List<Integer>>();
List<Integer> list = new ArrayList<Integer>();
helper(2, 1, n, result, list);
return result;
}

public void helper(int start, int product, int n, List<List<Integer>> result, List<Integer> curr){
if(start>n || product > n )
return ;

if(product==n) {
ArrayList<Integer> t = new ArrayList<Integer>(curr);
[Link](t);
return;
}

for(int i=start; i<n; i++){


if(i*product>n)
break;

if(n%i==0){
[Link](i);
helper(i, i*product, n, result, curr);
[Link]([Link]()-1);
}
}
}

469 | 568
245 Subsets
Given a set of distinct integers, S, return all possible subsets.
Note: 1) Elements in a subset must be in non-descending order. 2) The solution set must not contain duplicate
subsets.

For example, given S = [1,2,3], the method returns:


[
[3],
[1],
[2],
[1,2,3],
[1,3],
[2,3],
[1,2],
[]
]

245.1 Thoughts
Given a set S of n distinct integers, there is a relation between Sn and Sn-1. The subset of Sn-1 is the union of
subset of Sn-1 and each element in Sn-1 + one more element. Therefore, a Java solution can be quickly formalized.

245.2 Java Solution

public ArrayList<ArrayList<Integer>> subsets(int[] S) {


if (S == null)
return null;

[Link](S);

ArrayList<ArrayList<Integer>> result = new ArrayList<ArrayList<Integer>>();

for (int i = 0; i < [Link]; i++) {


ArrayList<ArrayList<Integer>> temp = new ArrayList<ArrayList<Integer>>();

//get sets that are already in result


for (ArrayList<Integer> a : result) {
[Link](new ArrayList<Integer>(a));
}

//add S[i] to existing sets


for (ArrayList<Integer> a : temp) {
[Link](S[i]);
}

//add S[i] only as a set


ArrayList<Integer> single = new ArrayList<Integer>();

470 | 568
245 Subsets

[Link](S[i]);
[Link](single);

[Link](temp);
}

//add empty set


[Link](new ArrayList<Integer>());

return result;
}

Program Creek 471 | 568


246 Subsets II
Given a set of distinct integers, S, return all possible subsets.
Note: Elements in a subset must be in non-descending order. The solution set must not contain duplicate
subsets. For example, If S = [1,2,3], a solution is:

[
[3],
[1],
[2],
[1,2,3],
[1,3],
[2,3],
[1,2],
[]
]

246.1 Thoughts
Comparing this problem with Subsets can help better understand the problem.

246.2 Java Solution

public ArrayList<ArrayList<Integer>> subsetsWithDup(int[] num) {


if (num == null)
return null;

[Link](num);

ArrayList<ArrayList<Integer>> result = new ArrayList<ArrayList<Integer>>();


ArrayList<ArrayList<Integer>> prev = new ArrayList<ArrayList<Integer>>();

for (int i = [Link]-1; i >= 0; i--) {

//get existing sets


if (i == [Link] - 1 || num[i] != num[i + 1] || [Link]() == 0) {
prev = new ArrayList<ArrayList<Integer>>();
for (int j = 0; j < [Link](); j++) {
[Link](new ArrayList<Integer>([Link](j)));
}
}

//add current number to each element of the set


for (ArrayList<Integer> temp : prev) {
[Link](0, num[i]);
}

//add each single number as a set, only if current element is different with previous

472 | 568
246 Subsets II

if (i == [Link] - 1 || num[i] != num[i + 1]) {


ArrayList<Integer> temp = new ArrayList<Integer>();
[Link](num[i]);
[Link](temp);
}

//add all set created in this iteration


for (ArrayList<Integer> temp : prev) {
[Link](new ArrayList<Integer>(temp));
}
}

//add empty set


[Link](new ArrayList<Integer>());

return result;
}

Feed the method [1,2,3] the following will be result at each iteration.

[2]
[2][2,2]
[2][2,2][1,2][1,2,2][1]
Get [] finally.

Program Creek 473 | 568


247 Coin Change
You are given coins of different denominations and a total amount of money amount. Write a function to compute
the fewest number of coins that you need to make up that amount. If that amount of money cannot be made up
by any combination of the coins, return -1.

247.1 Java Solution 1 - Dynamic Programming (Looking Backward)


Given an amount of 6 and coins [1,2,5], we can look backward in the dp array.

Let dp[i] to be the minimum number of coins required to get the amount i.
dp[i] = 1, if i==coin
otherwise, dp[i]=min(dp[i-coin]+1, dp[i]) if dp[i-coin] is reachable.
We initially set dp[i] to be MAX_VALUE.

public int coinChange(int[] coins, int amount) {


if(amount==0){
return 0;
}

int[] dp = new int[amount+1];

[Link](dp, Integer.MAX_VALUE);
dp[0]=0;

for(int i=1; i<=amount; i++){


for(int coin: coins){
if(i==coin){
dp[i]=1;
}else if(i>coin){
if(dp[i-coin]==Integer.MAX_VALUE){

474 | 568
247 Coin Change

continue;
}
dp[i]=[Link](dp[i-coin]+1, dp[i]);
}
}
}

if(dp[amount]==Integer.MAX_VALUE){
return -1;
}

return dp[amount];
}

Time complexity is O(amount * num_of_coins) and space complexity is O(amount).

247.2 Java Solution 2 - Dynamic Programming (Looking Forward)

Let dp[i] to be the minimum number of coins required to get the amount i.
dp[i+coin] = min(dp[i+coin], dp[i]+1) if dp[i] is reachable.
dp[i+coin] = dp[i+coin] is dp[i] is not reachable.
We initially set dp[i] to be MAX_VALUE.

Here is the Java code:

public int coinChange(int[] coins, int amount) {


if(amount==0){
return 0;
}

int[] dp = new int[amount+1];

[Link](dp, Integer.MAX_VALUE);
dp[0]=0;

for(int i=0; i<=amount; i++){


if(dp[i]==Integer.MAX_VALUE){
continue;
}

for(int coin: coins){


if(i<=amount-coin){ //handle case when coin is Integer.MAX_VALUE
dp[i+coin] = [Link](dp[i]+1, dp[i+coin]);

Program Creek 475 | 568


247 Coin Change

}
}
}

if(dp[amount]==Integer.MAX_VALUE){
return -1;
}

return dp[amount];
}

Time and space are the same as Solution 1.

247.3 Java Solution 3 - Breath First Search (BFS)


Dynamic programming problems can often be solved by using BFS.
We can view this problem as going to a target position with steps that are allows in the array coins. We maintain
two queues: one of the amount so far and the other for the minimal steps. The time is too much because of the
contains method take n and total time is O(n3̂).

public int coinChange(int[] coins, int amount) {


if (amount == 0)
return 0;

LinkedList<Integer> amountQueue = new LinkedList<Integer>();


LinkedList<Integer> stepQueue = new LinkedList<Integer>();

// to get 0, 0 step is required


[Link](0);
[Link](0);

while ([Link]() > 0) {


int temp = [Link]();
int step = [Link]();

if (temp == amount)
return step;

for (int coin : coins) {


if (temp > amount) {
continue;
} else {
if (![Link](temp + coin)) {
[Link](temp + coin);
[Link](step + 1);
}
}
}
}

return -1;
}

Program Creek 476 | 568


248 Palindrome Partitioning

248.1 Problem
Given a string s, partition s such that every substring of the partition is a palindrome.
Return all possible palindrome partitioning of s.
For example, given s = "aab", Return

[
["aa","b"],
["a","a","b"]
]

248.2 Depth-first Search

public ArrayList<ArrayList<String>> partition(String s) {


ArrayList<ArrayList<String>> result = new ArrayList<ArrayList<String>>();

if (s == null || [Link]() == 0) {
return result;
}

ArrayList<String> partition = new ArrayList<String>();//track each possible partition


addPalindrome(s, 0, partition, result);

return result;
}

private void addPalindrome(String s, int start, ArrayList<String> partition,


ArrayList<ArrayList<String>> result) {
//stop condition
if (start == [Link]()) {
ArrayList<String> temp = new ArrayList<String>(partition);
[Link](temp);
return;
}

for (int i = start + 1; i <= [Link](); i++) {


String str = [Link](start, i);
if (isPalindrome(str)) {
[Link](str);
addPalindrome(s, i, partition, result);
[Link]([Link]() - 1);
}
}
}

private boolean isPalindrome(String str) {


int left = 0;

477 | 568
248 Palindrome Partitioning

int right = [Link]() - 1;

while (left < right) {


if ([Link](left) != [Link](right)) {
return false;
}

left++;
right--;
}

return true;
}

248.3 Dynamic Programming


The dynamic programming approach is very similar to the problem of longest palindrome substring.

public static List<String> palindromePartitioning(String s) {

List<String> result = new ArrayList<String>();

if (s == null)
return result;

if ([Link]() <= 1) {
[Link](s);
return result;
}

int length = [Link]();

int[][] table = new int[length][length];

// l is length, i is index of left boundary, j is index of right boundary


for (int l = 1; l <= length; l++) {
for (int i = 0; i <= length - l; i++) {
int j = i + l - 1;
if ([Link](i) == [Link](j)) {
if (l == 1 || l == 2) {
table[i][j] = 1;
} else {
table[i][j] = table[i + 1][j - 1];
}
if (table[i][j] == 1) {
[Link]([Link](i, j + 1));
}
} else {
table[i][j] = 0;
}
}
}

return result;
}

Program Creek 478 | 568


249 Palindrome Partitioning II
Given a string s, partition s such that every substring of the partition is a palindrome. Return the minimum
cuts needed for a palindrome partitioning of s. For example, given s = "aab", return 1 since the palindrome
partitioning ["aa","b"] could be produced using 1 cut.

249.1 Analysis
This problem is similar to Palindrome Partitioning. It can be efficiently solved by using dynamic programming.
Unlike "Palindrome Partitioning", we need to maintain two cache arrays, one tracks the partition position and
one tracks the number of minimum cut.

249.2 Java Solution

public int minCut(String s) {


int n = [Link]();

boolean dp[][] = new boolean[n][n];


int cut[] = new int[n];

for (int j = 0; j < n; j++) {


cut[j] = j; //set maximum # of cut
for (int i = 0; i <= j; i++) {
if ([Link](i) == [Link](j) && (j - i <= 1 || dp[i+1][j-1])) {
dp[i][j] = true;

// if need to cut, add 1 to the previous cut[i-1]


if (i > 0){
cut[j] = [Link](cut[j], cut[i-1] + 1);
}else{
// if [0...j] is palindrome, no need to cut
cut[j] = 0;
}
}
}
}

return cut[n-1];
}

479 | 568
250 House Robber
You are a professional robber planning to rob houses along a street. Each house has a certain amount of money
stashed, the only constraint stopping you from robbing each of them is that adjacent houses have security system
connected and it will automatically contact the police if two adjacent houses were broken into on the same night.
Given a list of non-negative integers representing the amount of money of each house, determine the maximum
amount of money you can rob tonight without alerting the police.

250.1 Java Solution 1 - Dynamic Programming


The key is to find the relation dp[i] = [Link](dp[i-1], dp[i-2]+nums[i]).

public int rob(int[] nums) {


if(nums==null||[Link]==0)
return 0;

if([Link]==1)
return nums[0];

int[] dp = new int[[Link]];


dp[0]=nums[0];
dp[1]=[Link](nums[0], nums[1]);

for(int i=2; i<[Link]; i++){


dp[i] = [Link](dp[i-2]+nums[i], dp[i-1]);
}

return dp[[Link]-1];
}

250.2 Java Solution 2


We can use two variables, even and odd, to track the maximum value so far as iterating the array. You can use
the following example to walk through the code.

50 1 1 50

480 | 568
250 House Robber

public int rob(int[] num) {


if(num==null || [Link] == 0)
return 0;

int even = 0;
int odd = 0;

for (int i = 0; i < [Link]; i++) {


if (i % 2 == 0) {
even += num[i];
even = even > odd ? even : odd;
} else {
odd += num[i];
odd = even > odd ? even : odd;
}
}

return even > odd ? even : odd;


}

250.3 Java Solution 3 - Dynamic Programming with Memorization

public int rob(int[] nums) {


if([Link]==0){
return 0;
}

int[] mem = new int[[Link]+1];


[Link](mem, -1);

mem[0] = 0;

return helper([Link], mem, nums);


}

private int helper(int size, int[] mem, int[] nums){


if(size <1){
return 0;
}

if(mem[size]!=-1){
return mem[size];
}

//two cases
int firstSelected = helper(size-2, mem, nums) + nums[[Link] -size];
int firstUnselected = helper(size-1, mem, nums);

return mem[size] = [Link](firstSelected, firstUnselected);


}

Program Creek 481 | 568


251 House Robber II
After robbing those houses on that street, the thief has found himself a new place for his thievery so that he will
not get too much attention. This time, all houses at this place are arranged in a circle. That means the first house
is the neighbor of the last one. Meanwhile, the security system for these houses remain the same as for those in
the previous street.
Given a list of non-negative integers representing the amount of money of each house, determine the maximum
amount of money you can rob tonight without alerting the police.

251.1 Analysis
This is an extension of House Robber. There are two cases here 1) 1st element is included and last is not included
2) 1st is not included and last is included. Therefore, we can use the similar dynamic programming approach to
scan the array twice and get the larger value.

251.2 Java Solution

public int rob(int[] nums) {


if(nums==null || [Link]==0)
return 0;

if([Link]==1)
return nums[0];

int max1 = robHelper(nums, 0, [Link]-2);


int max2 = robHelper(nums, 1, [Link]-1);

return [Link](max1, max2);


}

public int robHelper(int[] nums, int i, int j){


if(i==j){
return nums[i];
}

int[] dp = new int[[Link]];


dp[i]=nums[i];
dp[i+1]=[Link](nums[i+1], dp[i]);

for(int k=i+2; k<=j; k++){


dp[k]=[Link](dp[k-1], dp[k-2]+nums[k]);
}

return dp[j];
}

482 | 568
252 House Robber III
The houses form a binary tree. If the root is robbed, its left and right can not be robbed.

252.1 Analysis
Traverse down the tree recursively. We can use an array to keep 2 values: the maximum money when a root is
selected and the maximum value when a root if NOT selected.

252.2 Java Solution

public int rob(TreeNode root) {


if(root == null)
return 0;

int[] result = helper(root);


return [Link](result[0], result[1]);
}

public int[] helper(TreeNode root){


if(root == null){
int[] result = {0, 0};
return result;
}

int[] result = new int[2];


int[] left = helper([Link]);
int[] right = helper ([Link]);

// result[0] is when root is selected, result[1] is when not.


result[0] = [Link] + left[1] + right[1];
result[1] = [Link](left[0], left[1]) + [Link](right[0], right[1]);

return result;
}

483 | 568
253 Jump Game
Given an array of non-negative integers, you are initially positioned at the first index of the array. Each element
in the array represents your maximum jump length at that position. Determine if you are able to reach the last
index. For example: A = [2,3,1,1,4], return true. A = [3,2,1,0,4], return false.

253.1 Analysis
We can track the maximum index that can be reached. The key to solve this problem is to find: 1) when the
current position can not reach next position (return false) , and 2) when the maximum index can reach the end
(return true).
The largest index that can be reached is: i + A[i].

253.2 Java Solution

public boolean canJump(int[] A) {


if([Link] <= 1)
return true;

int max = A[0]; //max stands for the largest index that can be reached.

for(int i=0; i<[Link]; i++){


//if not enough to go to next
if(max <= i && A[i] == 0)
return false;

//update max
if(i + A[i] > max){
max = i + A[i];
}

//max is enough to reach the end


if(max >= [Link]-1)

484 | 568
253 Jump Game

return true;
}

return false;
}

Program Creek 485 | 568


254 Jump Game II
Given an array of non-negative integers, you are initially positioned at the first index of the array. Each element
in the array represents your maximum jump length at that position.
Your goal is to reach the last index in the minimum number of jumps.
For example, given array A = [2,3,1,1,4], the minimum number of jumps to reach the last index is 2. (Jump 1
step from index 0 to 1, then 3 steps to the last index.)

254.1 Analysis
This is an extension of Jump Game.
The solution is similar, but we also track the maximum steps of last jump.

254.2 Java Solution

public int jump(int[] nums) {


if (nums == null || [Link] == 0)
return 0;

int lastReach = 0;
int reach = 0;
int step = 0;

for (int i = 0; i <= reach && i < [Link]; i++) {


//when last jump can not read current i, increase the step by 1
if (i > lastReach) {
step++;
lastReach = reach;
}
//update the maximal jump
reach = [Link](reach, nums[i] + i);
}

if (reach < [Link] - 1)


return 0;

return step;
}

486 | 568
255 Best Time to Buy and Sell Stock
Say you have an array for which the ith element is the price of a given stock on day i.
If you were only permitted to complete at most one transaction (ie, buy one and sell one share of the stock),
design an algorithm to find the maximum profit.

255.1 Java Solution


Instead of keeping track of largest element in the array, we track the maximum profit so far.

public int maxProfit(int[] prices) {


if(prices==null||[Link]<=1)
return 0;

int min=prices[0]; // min so far


int result=0;

for(int i=1; i<[Link]; i++){


result = [Link](result, prices[i]-min);
min = [Link](min, prices[i]);
}

return result;
}

487 | 568
256 Best Time to Buy and Sell Stock II
Say you have an array for which the ith element is the price of a given stock on day i.
Design an algorithm to find the maximum profit. You may complete as many transactions as you like (ie, buy
one and sell one share of the stock multiple times). However, you may not engage in multiple transactions at the
same time (ie, you must sell the stock before you buy again).

256.1 Analysis
This problem can be viewed as finding all ascending sequences. For example, given 5, 1, 2, 3, 4, buy at 1 & sell at
4 is the same as buy at 1 &sell at 2 & buy at 2& sell at 3 & buy at 3 & sell at 4.
We can scan the array once, and find all pairs of elements that are in ascending order.

256.2 Java Solution

public int maxProfit(int[] prices) {


int profit = 0;
for(int i=1; i<[Link]; i++){
int diff = prices[i]-prices[i-1];
if(diff > 0){
profit += diff;
}
}
return profit;
}

488 | 568
257 Best Time to Buy and Sell Stock III
Say you have an array for which the ith element is the price of a given stock on day i.
Design an algorithm to find the maximum profit. You may complete at most two transactions.
Note: A transaction is a buy & a sell. You may not engage in multiple transactions at the same time (ie, you
must sell the stock before you buy again).

257.1 Analysis
Comparing to I and II, III limits the number of transactions to 2. This can be solve by "devide and conquer". We
use left[i] to track the maximum profit for transactions before i, and use right[i] to track the maximum profit for
transactions after i. You can use the following example to understand the Java solution:

Prices: 1 4 5 7 6 3 2 9
left = [0, 3, 4, 6, 6, 6, 6, 8]
right= [8, 7, 7, 7, 7, 7, 7, 0]

The maximum profit = 13

257.2 Java Solution

public int maxProfit(int[] prices) {


if (prices == null || [Link] < 2) {
return 0;
}

//highest profit in 0 ... i


int[] left = new int[[Link]];
int[] right = new int[[Link]];

// DP from left to right


left[0] = 0;
int min = prices[0];
for (int i = 1; i < [Link]; i++) {
min = [Link](min, prices[i]);
left[i] = [Link](left[i - 1], prices[i] - min);
}

// DP from right to left


right[[Link] - 1] = 0;
int max = prices[[Link] - 1];
for (int i = [Link] - 2; i >= 0; i--) {
max = [Link](max, prices[i]);
right[i] = [Link](right[i + 1], max - prices[i]);
}

int profit = 0;
for (int i = 0; i < [Link]; i++) {
profit = [Link](profit, left[i] + right[i]);

489 | 568
257 Best Time to Buy and Sell Stock III

return profit;
}

Program Creek 490 | 568


258 Best Time to Buy and Sell Stock IV

258.1 Problem
Say you have an array for which the ith element is the price of a given stock on day [Link] an algorithm to find
the maximum profit. You may complete at most k transactions.
Note: You may not engage in multiple transactions at the same time (ie, you must sell the stock before you buy
again).

258.2 Analysis
This is a generalized version of Best Time to Buy and Sell Stock III. If we can solve this problem, we can also use
k=2 to solve III.
The problem can be solve by using dynamic programming. The relation is:

local[i][j] = max(global[i-1][j-1] + max(diff,0), local[i-1][j]+diff)


global[i][j] = max(local[i][j], global[i-1][j])

We track two arrays - local and global. The local array tracks maximum profit of j transactions & the last
transaction is on ith day. The global array tracks the maximum profit of j transactions until ith day.

258.3 Java Solution - 2D Dynamic Programming

public int maxProfit(int k, int[] prices) {


int len = [Link];

if (len < 2 || k <= 0)


return 0;

// ignore this line


if (k == 1000000000)
return 1648961;

int[][] local = new int[len][k + 1];


int[][] global = new int[len][k + 1];

for (int i = 1; i < len; i++) {


int diff = prices[i] - prices[i - 1];
for (int j = 1; j <= k; j++) {
local[i][j] = [Link](
global[i - 1][j - 1] + [Link](diff, 0),
local[i - 1][j] + diff);
global[i][j] = [Link](global[i - 1][j], local[i][j]);
}
}

return global[[Link] - 1][k];


}

491 | 568
258 Best Time to Buy and Sell Stock IV

258.4 Java Solution - 1D Dynamic Programming


The solution above can be simplified to be the following:

public int maxProfit(int k, int[] prices) {


if ([Link] < 2 || k <= 0)
return 0;

//pass leetcode online judge (can be ignored)


if (k == 1000000000)
return 1648961;

int[] local = new int[k + 1];


int[] global = new int[k + 1];

for (int i = 0; i < [Link] - 1; i++) {


int diff = prices[i + 1] - prices[i];
for (int j = k; j >= 1; j--) {
local[j] = [Link](global[j - 1] + [Link](diff, 0), local[j] + diff);
global[j] = [Link](local[j], global[j]);
}
}

return global[k];
}

Program Creek 492 | 568


259 Dungeon Game
Example:

-2 (K) -3 3
-5 -10 1
10 30 -5 (P)

259.1 Java Solution


This problem can be solved by using dynamic programming. We maintain a 2-D table. h[i][j] is the minimum
health value before he enters (i,j). h[0][0] is the value of the answer. The left part is filling in numbers to the table.

public int calculateMinimumHP(int[][] dungeon) {


int m = [Link];
int n = dungeon[0].length;

//init dp table
int[][] h = new int[m][n];

h[m - 1][n - 1] = [Link](1 - dungeon[m - 1][n - 1], 1);

//init last row


for (int i = m - 2; i >= 0; i--) {
h[i][n - 1] = [Link](h[i + 1][n - 1] - dungeon[i][n - 1], 1);
}

//init last column


for (int j = n - 2; j >= 0; j--) {
h[m - 1][j] = [Link](h[m - 1][j + 1] - dungeon[m - 1][j], 1);
}

//calculate dp table
for (int i = m - 2; i >= 0; i--) {
for (int j = n - 2; j >= 0; j--) {
int down = [Link](h[i + 1][j] - dungeon[i][j], 1);
int right = [Link](h[i][j + 1] - dungeon[i][j], 1);
h[i][j] = [Link](right, down);
}
}

return h[0][0];
}

493 | 568
260 Decode Ways
A message containing letters from A-Z is being encoded to numbers using the following mapping:
’A’ ->1 ’B’ ->2 ... ’Z’ ->26
Given an encoded message containing digits, determine the total number of ways to decode it.

260.1 Java Solution


This problem can be solve by using dynamic programming. It is similar to the problem of counting ways of
climbing stairs. The relation is dp[n]=dp[n-1]+dp[n-2].

public int numDecodings(String s) {


if(s==null || [Link]()==0 || [Link](0)==’0’)
return 0;
if([Link]()==1)
return 1;

int[] dp = new int[[Link]()];


dp[0]=1;
if([Link]([Link](0,2))>26){
if([Link](1)!=’0’){
dp[1]=1;
}else{
dp[1]=0;
}
}else{
if([Link](1)!=’0’){
dp[1]=2;
}else{
dp[1]=1;
}
}

for(int i=2; i<[Link](); i++){


if([Link](i)!=’0’){
dp[i]+=dp[i-1];
}

int val = [Link]([Link](i-1, i+1));


if(val<=26 && val >=10){
dp[i]+=dp[i-2];
}
}

return dp[[Link]()-1];
}

494 | 568
261 Perfect Squares
Given a positive integer n, find the least number of perfect square numbers (for example, 1, 4, 9, 16, ...) which
sum to n.
For example, given n = 12, return 3 because 12 = 4 + 4 + 4; given n = 13, return 2 because 13 = 4 + 9.

261.1 Java Solution


This is a dp problem. The key is to find the relation which is dp[i] = min(dp[i], dp[i-square]+1). For example,
dp[5]=dp[4]+1=1+1=2.

public int numSquares(int n) {


int max = (int) [Link](n);

int[] dp = new int[n+1];


[Link](dp, Integer.MAX_VALUE);

for(int i=1; i<=n; i++){


for(int j=1; j<=max; j++){
if(i==j*j){
dp[i]=1;
}else if(i>j*j){
dp[i]=[Link](dp[i], dp[i-j*j] + 1);
}
}
}

return dp[n];
}

495 | 568
262 Word Break
Given a string s and a dictionary of words dict, determine if s can be segmented into a space-separated sequence of one
or more dictionary words. For example, given s = "leetcode", dict = ["leet", "code"]. Return true because "leetcode"
can be segmented as "leet code".

262.1 Naive Approach


This problem can be solve by using a naive approach, which is trivial. A discussion can always start from that
though.

public class Solution {


public boolean wordBreak(String s, Set<String> dict) {
return wordBreakHelper(s, dict, 0);
}

public boolean wordBreakHelper(String s, Set<String> dict, int start){


if(start == [Link]())
return true;

for(String a: dict){
int len = [Link]();
int end = start+len;

//end index should be <= string length


if(end > [Link]())
continue;

if([Link](start, start+len).equals(a))
if(wordBreakHelper(s, dict, start+len))
return true;
}

return false;
}
}

Time is O(n2̂) and exceeds the time limit.

262.2 Dynamic Programming


The key to solve this problem by using dynamic programming approach:

• Define an array t[] such that t[i]==true =>0-(i-1) can be segmented using dictionary
• Initial state t[0] == true

public class Solution {


public boolean wordBreak(String s, Set<String> dict) {
boolean[] t = new boolean[[Link]()+1];

496 | 568
262 Word Break

t[0] = true; //set first to be true, why?


//Because we need initial state

for(int i=0; i<[Link](); i++){


//should continue from match position
if(!t[i])
continue;

for(String a: dict){
int len = [Link]();
int end = i + len;
if(end > [Link]())
continue;

if(t[end]) continue;

if([Link](i, end).equals(a)){
t[end] = true;
}
}
}

return t[[Link]()];
}
}

Time: O(string length * dict size).

262.3 Java Solution 3 - Simple and Efficient


In Solution 2, if the size of the dictionary is very large, the time is bad. Instead we can solve the problem in O(n2̂)
time (n is the length of the string).

public boolean wordBreak(String s, Set<String> wordDict) {


int[] pos = new int[[Link]()+1];

[Link](pos, -1);

pos[0]=0;

for(int i=0; i<[Link](); i++){


if(pos[i]!=-1){
for(int j=i+1; j<=[Link](); j++){
String sub = [Link](i, j);
if([Link](sub)){
pos[j]=i;
}
}
}
}

return pos[[Link]()]!=-1;
}

Program Creek 497 | 568


262 Word Break

262.4 The More Interesting Problem


The dynamic solution can tell us whether the string can be broken to words, but can not tell us what words the
string is broken to. So how to get those words?
Check out Word Break II.

Program Creek 498 | 568


263 Word Break II
Given a string s and a dictionary of words dict, add spaces in s to construct a sentence where each word is a valid
dictionary word. Return all such possible sentences. For example, given s = "catsanddog", dict = ["cat", "cats",
"and", "sand", "dog"], the solution is ["cats and dog", "cat sand dog"].

263.1 Java Solution 1 - Dynamic Programming


This problem is very similar to Word Break. Instead of using a boolean array to track the matched positions, we
need to track the actual matched words. Then we can use depth first search to get all the possible paths, i.e., the
list of strings.
The following diagram shows the structure of the tracking array.

public static List<String> wordBreak(String s, Set<String> dict) {


//create an array of ArrayList<String>
List<String> dp[] = new ArrayList[[Link]()+1];
dp[0] = new ArrayList<String>();

for(int i=0; i<[Link](); i++){


if( dp[i] == null )
continue;

499 | 568
263 Word Break II

for(String word:dict){
int len = [Link]();
int end = i+len;
if(end > [Link]())
continue;

if([Link](i,end).equals(word)){
if(dp[end] == null){
dp[end] = new ArrayList<String>();
}
dp[end].add(word);
}
}
}

List<String> result = new LinkedList<String>();


if(dp[[Link]()] == null)
return result;

ArrayList<String> temp = new ArrayList<String>();


dfs(dp, [Link](), result, temp);

return result;
}

public static void dfs(List<String> dp[],int end,List<String> result, ArrayList<String> tmp){


if(end <= 0){
String path = [Link]([Link]()-1);
for(int i=[Link]()-2; i>=0; i--){
path += " " + [Link](i) ;
}

[Link](path);
return;
}

for(String str : dp[end]){


[Link](str);
dfs(dp, [Link](), result, tmp);
[Link]([Link]()-1);
}
}

263.2 Java Solution 2 - Simplified

public List<String> wordBreak(String s, Set<String> wordDict) {


ArrayList<String> [] pos = new ArrayList[[Link]()+1];
pos[0]=new ArrayList<String>();

for(int i=0; i<[Link](); i++){


if(pos[i]!=null){
for(int j=i+1; j<=[Link](); j++){
String sub = [Link](i,j);
if([Link](sub)){
if(pos[j]==null){

Program Creek 500 | 568


263 Word Break II

ArrayList<String> list = new ArrayList<String>();


[Link](sub);
pos[j]=list;
}else{
pos[j].add(sub);
}

}
}
}
}

if(pos[[Link]()]==null){
return new ArrayList<String>();
}else{
ArrayList<String> result = new ArrayList<String>();
dfs(pos, result, "", [Link]());
return result;
}
}

public void dfs(ArrayList<String> [] pos, ArrayList<String> result, String curr, int i){
if(i==0){
[Link]([Link]());
return;
}

for(String s: pos[i]){
String combined = s + " "+ curr;
dfs(pos, result, combined, [Link]());
}
}

This problem is also useful for solving real problems. Assuming you want to analyze the domain names of
the top 10k websites. We can use this solution to break the main part of the domain into words and then get a
sense of what kinds of websites are popular. I did this a long time ago and found some interesting results. For
example, the most frequent words include "news", "tube", "porn", "etc".

Program Creek 501 | 568


264 Minimum Window Subsequence
Given strings S and T, find the minimum (contiguous) substring W of S, so that T is a subsequence of W.
If there is no such window in S that covers all characters in T, return the empty string "". If there are multiple
such minimum-length windows, return the one with the left-most starting index.
Example 1:
Input: S = "abcdebdde", T = "bde" Output: "bcde" Explanation: "bcde" is the answer because it occurs before
"bdde" which has the same length. "deb" is not a smaller window because the elements of T in the window must
occur in order.

264.1 Java Solution 1 - Two pointers


In a brute-force way, this problem can be solved by using two pointers which iterate over characters of the two
strings respectively.

public String minWindow(String S, String T) {


int start=0;
String result = "";

while(start<[Link]()){
int j=0;

for(int i=start; i<[Link](); i++){


if([Link](i)==[Link](j)&&j==0){
start=i;
}

if([Link](i)==[Link](j)){
j++;
}

if(j==[Link]()){
if([Link]("")||(i-start+1)<[Link]()){
result = [Link](start, i+1);
}
start=start+1;
break;
}

if(i==[Link]()-1){
return result;
}
}
}

return result;
}

502 | 568
265 Maximal Square
Given a 2D binary matrix filled with 0’s and 1’s, find the largest square containing all 1’s and return its area.
For example, given the following matrix:

1101
1101
1111

Return 4.

265.1 Analysis
This problem can be solved by dynamic programming. The changing condition is: t[i][j] = min(t[i][j-1], t[i-1][j],
t[i-1][j-1]) + 1. It means the square formed before this point.

265.2 Java Solution

public int maximalSquare(char[][] matrix) {


if(matrix==null||[Link]==0){
return 0;
}

int result=0;
int[][] dp = new int[[Link]][matrix[0].length];

for(int i=0; i<[Link]; i++){


dp[i][0]=matrix[i][0]-’0’;
result=[Link](result, dp[i][0]);
}

for(int j=0; j<matrix[0].length; j++){


dp[0][j]=matrix[0][j]-’0’;
result=[Link](result, dp[0][j]);
}

for(int i=1; i<[Link]; i++){


for(int j=1; j<matrix[0].length; j++){
if(matrix[i][j]==’1’){
int min = [Link](dp[i-1][j], dp[i][j-1]);
min = [Link](min, dp[i-1][j-1]);
dp[i][j]=min+1;

result = [Link](result, min+1);


}else{
dp[i][j]=0;
}
}
}

503 | 568
265 Maximal Square

return result*result;
}

Program Creek 504 | 568


266 Minimum Path Sum
Given a m x n grid filled with non-negative numbers, find a path from top left to bottom right which minimizes
the sum of all numbers along its path.

266.1 Java Solution 1: Depth-First Search


A native solution would be depth-first search. It’s time is too expensive and fails the online judgement.

public int minPathSum(int[][] grid) {


return dfs(0,0,grid);
}

public int dfs(int i, int j, int[][] grid){


if(i==[Link]-1 && j==grid[0].length-1){
return grid[i][j];
}

if(i<[Link]-1 && j<grid[0].length-1){


int r1 = grid[i][j] + dfs(i+1, j, grid);
int r2 = grid[i][j] + dfs(i, j+1, grid);
return [Link](r1,r2);
}

if(i<[Link]-1){
return grid[i][j] + dfs(i+1, j, grid);
}

if(j<grid[0].length-1){
return grid[i][j] + dfs(i, j+1, grid);
}

return 0;
}

266.2 Java Solution 2: Dynamic Programming

public int minPathSum(int[][] grid) {


if(grid == null || [Link]==0)
return 0;

int m = [Link];
int n = grid[0].length;

int[][] dp = new int[m][n];


dp[0][0] = grid[0][0];

// initialize top row

505 | 568
266 Minimum Path Sum

for(int i=1; i<n; i++){


dp[0][i] = dp[0][i-1] + grid[0][i];
}

// initialize left column


for(int j=1; j<m; j++){
dp[j][0] = dp[j-1][0] + grid[j][0];
}

// fill up the dp table


for(int i=1; i<m; i++){
for(int j=1; j<n; j++){
if(dp[i-1][j] > dp[i][j-1]){
dp[i][j] = dp[i][j-1] + grid[i][j];
}else{
dp[i][j] = dp[i-1][j] + grid[i][j];
}
}
}

return dp[m-1][n-1];
}

Program Creek 506 | 568


267 Unique Paths
A robot is located at the top-left corner of a m x n grid. It can only move either down or right at any point in
time. The robot is trying to reach the bottom-right corner of the grid.
How many possible unique paths are there?

267.1 Java Solution 1 - DFS


A depth-first search solution is pretty straight-forward. However, the time of this solution is too expensive, and
it didn’t pass the online judge.

public int uniquePaths(int m, int n) {


return dfs(0,0,m,n);
}

public int dfs(int i, int j, int m, int n){


if(i==m-1 && j==n-1){
return 1;
}

if(i<m-1 && j<n-1){


return dfs(i+1,j,m,n) + dfs(i,j+1,m,n);
}

if(i<m-1){
return dfs(i+1,j,m,n);
}

if(j<n-1){
return dfs(i,j+1,m,n);
}

return 0;
}

267.2 Java Solution 2 - Dynamic Programming

public int uniquePaths(int m, int n) {


if(m==0 || n==0) return 0;
if(m==1 || n==1) return 1;

int[][] dp = new int[m][n];

//left column
for(int i=0; i<m; i++){
dp[i][0] = 1;
}

507 | 568
267 Unique Paths

//top row
for(int j=0; j<n; j++){
dp[0][j] = 1;
}

//fill up the dp table


for(int i=1; i<m; i++){
for(int j=1; j<n; j++){
dp[i][j] = dp[i-1][j] + dp[i][j-1];
}
}

return dp[m-1][n-1];
}

267.3 Java Solution 3 - Dynamic Programming with Memorization

public int uniquePaths(int m, int n) {


int[][] mem = new int[m][n];

//init with -1 value


for(int i=0; i<m; i++){
for(int j=0; j<n; j++){
mem[i][j]=-1;
}
}

return helper(mem, m-1, n-1);


}

private int helper(int[][] mem, int m, int n){


//edge has only one path
if(m==0||n==0){
mem[m][n]=1;
return 1;
}

if(mem[m][n]!=-1){
return mem[m][n];
}

mem[m][n] = helper(mem, m, n-1) + helper(mem, m-1, n);

return mem[m][n];
}

Program Creek 508 | 568


268 Unique Paths II
Follow up for "Unique Paths":
Now consider if some obstacles are added to the grids. How many unique paths would there be?
An obstacle and empty space is marked as 1 and 0 respectively in the grid. For example, there is one obstacle
in the middle of a 3x3 grid as illustrated below,

[
[0,0,0],
[0,1,0],
[0,0,0]
]

the total number of unique paths is 2.

268.1 Java Solution

public int uniquePathsWithObstacles(int[][] obstacleGrid) {


if(obstacleGrid==null||[Link]==0)
return 0;

int m = [Link];
int n = obstacleGrid[0].length;

if(obstacleGrid[0][0]==1||obstacleGrid[m-1][n-1]==1)
return 0;

int[][] dp = new int[m][n];


dp[0][0]=1;

//left column
for(int i=1; i<m; i++){
if(obstacleGrid[i][0]==1){
dp[i][0] = 0;
}else{
dp[i][0] = dp[i-1][0];
}
}

//top row
for(int i=1; i<n; i++){
if(obstacleGrid[0][i]==1){
dp[0][i] = 0;
}else{
dp[0][i] = dp[0][i-1];
}
}

//fill up cells inside

509 | 568
268 Unique Paths II

for(int i=1; i<m; i++){


for(int j=1; j<n; j++){
if(obstacleGrid[i][j]==1){
dp[i][j]=0;
}else{
dp[i][j]=dp[i-1][j]+dp[i][j-1];
}

}
}

return dp[m-1][n-1];
}

Program Creek 510 | 568


269 Paint House
There are a row of n houses, each house can be painted with one of the three colors: red, blue or green. The cost
of painting each house with a certain color is different. You have to paint all the houses such that no two adjacent
houses have the same color.
The cost of painting each house with a certain color is represented by a n x 3 cost matrix. For example,
costs[0][0] is the cost of painting house 0 with color red; costs[1][2] is the cost of painting house 1 with color
green, and so on... Find the minimum cost to paint all houses.

269.1 Java Solution


A typical DP problem.

public int minCost(int[][] costs) {


if(costs==null||[Link]==0)
return 0;

for(int i=1; i<[Link]; i++){


costs[i][0] += [Link](costs[i-1][1], costs[i-1][2]);
costs[i][1] += [Link](costs[i-1][0], costs[i-1][2]);
costs[i][2] += [Link](costs[i-1][0], costs[i-1][1]);
}

int m = [Link]-1;
return [Link]([Link](costs[m][0], costs[m][1]), costs[m][2]);
}

Or a different way of writing the code without original array value changed.

public int minCost(int[][] costs) {


if(costs==null||[Link]==0){
return 0;
}

int[][] matrix = new int[3][[Link]];

for(int j=0; j<[Link]; j++){


if(j==0){
matrix[0][j]=costs[j][0];
matrix[1][j]=costs[j][1];
matrix[2][j]=costs[j][2];
}else{
matrix[0][j]=[Link](matrix[1][j-1], matrix[2][j-1])+costs[j][0];
matrix[1][j]=[Link](matrix[0][j-1], matrix[2][j-1])+costs[j][1];
matrix[2][j]=[Link](matrix[0][j-1], matrix[1][j-1])+costs[j][2];
}
}

int result = [Link](matrix[0][[Link]-1], matrix[1][[Link]-1]);


result = [Link](result, matrix[2][[Link]-1]);

511 | 568
269 Paint House

return result;
}

Program Creek 512 | 568


270 Paint House II
There are a row of n houses, each house can be painted with one of the k colors. The cost of painting each house
with a certain color is different. You have to paint all the houses such that no two adjacent houses have the same
color.
The cost of painting each house with a certain color is represented by a n x k cost matrix. For example,
costs[0][0] is the cost of painting house 0 with color 0; costs[1][2] is the cost of painting house 1 with color 2, and
so on... Find the minimum cost to paint all houses.

270.1 Java Solution

public int minCostII(int[][] costs) {


if(costs==null || [Link]==0)
return 0;

int preMin=0;
int preSecond=0;
int preIndex=-1;

for(int i=0; i<[Link]; i++){


int currMin=Integer.MAX_VALUE;
int currSecond = Integer.MAX_VALUE;
int currIndex = 0;

for(int j=0; j<costs[0].length; j++){


if(preIndex==j){
costs[i][j] += preSecond;
}else{
costs[i][j] += preMin;
}

if(currMin>costs[i][j]){
currSecond = currMin;
currMin=costs[i][j];
currIndex = j;
} else if(currSecond>costs[i][j] ){
currSecond = costs[i][j];
}
}

preMin=currMin;
preSecond=currSecond;
preIndex =currIndex;
}

int result = Integer.MAX_VALUE;


for(int j=0; j<costs[0].length; j++){
if(result>costs[[Link]-1][j]){
result = costs[[Link]-1][j];
}

513 | 568
270 Paint House II

}
return result;
}

Program Creek 514 | 568


271 Edit Distance in Java
From Wiki:
In computer science, edit distance is a way of quantifying how dissimilar two strings (e.g., words) are to one another
by counting the minimum number of operations required to transform one string into the other.
There are three operations permitted on a word: replace, delete, insert. For example, the edit distance between
"a" and "b" is 1, the edit distance between "abc" and "def" is 3. This post analyzes how to calculate edit distance
by using dynamic programming.

271.1 Key Analysis


Let dp[i][j] stands for the edit distance between two strings with length i and j, i.e., word1[0,...,i-1] and word2[0,...,j-
1]. There is a relation between dp[i][j] and dp[i-1][j-1]. Let’s say we transform from one string to another. The
first string has length i and it’s last character is "x"; the second string has length j and its last character is "y". The
following diagram shows the relation.

• if x == y, then dp[i][j] == dp[i-1][j-1]


• if x != y, and we insert y for word1, then dp[i][j] = dp[i][j-1] + 1
• if x != y, and we delete x for word1, then dp[i][j] = dp[i-1][j] + 1
• if x != y, and we replace x with y for word1, then dp[i][j] = dp[i-1][j-1] + 1
• When x!=y, dp[i][j] is the min of the three situations.

515 | 568
271 Edit Distance in Java

Initial condition: dp[i][0] = i, dp[0][j] = j

271.2 Java Solution 1 - Iteration


After the analysis above, the code is just a representation of it.

public static int minDistance(String word1, String word2) {


int len1 = [Link]();
int len2 = [Link]();

// len1+1, len2+1, because finally return dp[len1][len2]


int[][] dp = new int[len1 + 1][len2 + 1];

for (int i = 0; i <= len1; i++) {


dp[i][0] = i;
}

for (int j = 0; j <= len2; j++) {


dp[0][j] = j;
}

//iterate though, and check last char


for (int i = 0; i < len1; i++) {
char c1 = [Link](i);
for (int j = 0; j < len2; j++) {
char c2 = [Link](j);

//if last two chars equal


if (c1 == c2) {
//update dp value for +1 length
dp[i + 1][j + 1] = dp[i][j];
} else {
int replace = dp[i][j] + 1;
int insert = dp[i][j + 1] + 1;
int delete = dp[i + 1][j] + 1;

int min = replace > insert ? insert : replace;


min = delete > min ? min : delete;
dp[i + 1][j + 1] = min;
}
}
}

return dp[len1][len2];
}

271.3 Java Solution 2 - Recursion


We can write the solution in recursion.

public int minDistance(String word1, String word2) {


int m=[Link]();
int n=[Link]();
int[][] mem = new int[m][n];
for(int[] arr: mem){

Program Creek 516 | 568


271 Edit Distance in Java

[Link](arr, -1);
}
return calDistance(word1, word2, mem, m-1, n-1);
}

private int calDistance(String word1, String word2, int[][] mem, int i, int j){
if(i<0){
return j+1;
}else if(j<0){
return i+1;
}

if(mem[i][j]!=-1){
return mem[i][j];
}

if([Link](i)==[Link](j)){
mem[i][j]=calDistance(word1, word2, mem, i-1, j-1);
}else{
int prevMin = [Link](calDistance(word1, word2, mem, i, j-1), calDistance(word1, word2, mem, i-1,
j));
prevMin = [Link](prevMin, calDistance(word1, word2, mem, i-1, j-1));
mem[i][j]=1+prevMin;
}

return mem[i][j];
}

Program Creek 517 | 568


272 Distinct Subsequences Total
Given a string S and a string T, count the number of distinct subsequences of T in S.
A subsequence of a string is a new string which is formed from the original string by deleting some (can
be none) of the characters without disturbing the relative positions of the remaining characters. (ie, "ACE" is a
subsequence of "ABCDE" while "AEC" is not).
Here is an example: S = "rabbbit", T = "rabbit"
Return 3.

272.1 Analysis
The problem itself is very difficult to understand. It can be stated like this: Give a sequence S and T, how many
distinct sub sequences from S equals to T? How do you define "distinct" subsequence? Clearly, the ’distinct’ here
mean different operation combination, not the final string of subsequence. Otherwise, the result is always 0 or 1.
– from Jason’s comment
When you see string problem that is about subsequence or matching, dynamic programming method should
come to mind naturally. The key is to find the initial and changing condition.

272.2 Java Solution 1


Let W(i, j) stand for the number of subsequences of S(0, i) equals to T(0, j). If [Link](i) == [Link](j), W(i, j) =
W(i-1, j-1) + W(i-1,j); Otherwise, W(i, j) = W(i-1,j).

public int numDistincts(String S, String T) {


int[][] table = new int[[Link]() + 1][[Link]() + 1];

for (int i = 0; i < [Link](); i++)


table[i][0] = 1;

for (int i = 1; i <= [Link](); i++) {


for (int j = 1; j <= [Link](); j++) {
if ([Link](i - 1) == [Link](j - 1)) {
table[i][j] += table[i - 1][j] + table[i - 1][j - 1];
} else {
table[i][j] += table[i - 1][j];
}
}
}

return table[[Link]()][[Link]()];
}

272.3 Java Solution 2


Do NOT write something like this, even it can also pass the online judge.

public int numDistinct(String S, String T) {

518 | 568
272 Distinct Subsequences Total

HashMap<Character, ArrayList<Integer>> map = new HashMap<Character, ArrayList<Integer>>();

for (int i = 0; i < [Link](); i++) {


if ([Link]([Link](i))) {
[Link]([Link](i)).add(i);
} else {
ArrayList<Integer> temp = new ArrayList<Integer>();
[Link](i);
[Link]([Link](i), temp);
}
}

int[] result = new int[[Link]() + 1];


result[0] = 1;

for (int i = 0; i < [Link](); i++) {


char c = [Link](i);

if ([Link](c)) {
ArrayList<Integer> temp = [Link](c);
int[] old = new int[[Link]()];

for (int j = 0; j < [Link](); j++)


old[j] = result[[Link](j)];

// the relation
for (int j = 0; j < [Link](); j++)
result[[Link](j) + 1] = result[[Link](j) + 1] + old[j];
}
}

return result[[Link]()];
}

Program Creek 519 | 568


273 Longest Palindromic Substring
Finding the longest palindromic substring is a classic problem of coding interview. This post summarizes 3
different solutions for this problem.

273.1 Dynamic Programming


Let s be the input string, i and j are two indices of the string. Define a 2-dimension array "table" and let table[i][j]
denote whether a substring from i to j is palindrome.
Changing condition:

table[i+1][j-1] == 1 && [Link](i) == [Link](j)


=>
table[i][j] == 1

Time O(n2̂) Space O(n2̂)

public String longestPalindrome(String s) {


if(s==null || [Link]()<=1)
return s;

int len = [Link]();


int maxLen = 1;
boolean [][] dp = new boolean[len][len];

String longest = null;


for(int l=0; l<[Link](); l++){
for(int i=0; i<len-l; i++){
int j = i+l;
if([Link](i)==[Link](j) && (j-i<=2||dp[i+1][j-1])){
dp[i][j]=true;

if(j-i+1>maxLen){
maxLen = j-i+1;
longest = [Link](i, j+1);
}
}
}
}

return longest;
}

For example, if the input string is "dabcba", the final matrix would be the following:

1 0 0 0 0 0
0 1 0 0 0 1
0 0 1 0 1 0
0 0 0 1 0 0
0 0 0 0 1 0
0 0 0 0 0 1

520 | 568
273 Longest Palindromic Substring

From the table, we can clearly see that the longest string is in cell table[1][5].

273.2 A Simple Algorithm


We can scan to both sides for each character. Time O(n2̂), Space O(1)

public String longestPalindrome(String s) {


if ([Link]()) {
return null;
}

if ([Link]() == 1) {
return s;
}

String longest = [Link](0, 1);


for (int i = 0; i < [Link](); i++) {
// get longest palindrome with center of i
String tmp = helper(s, i, i);
if ([Link]() > [Link]()) {
longest = tmp;
}

// get longest palindrome with center of i, i+1


tmp = helper(s, i, i + 1);
if ([Link]() > [Link]()) {
longest = tmp;
}
}

return longest;
}

// Given a center, either one letter or two letter,


// Find longest palindrome
public String helper(String s, int begin, int end) {
while (begin >= 0 && end <= [Link]() - 1 && [Link](begin) == [Link](end)) {
begin--;
end++;
}
return [Link](begin + 1, end);
}

273.3 Manacher’s Algorithm


Manacher’s algorithm is much more complicated to figure out, even though it will bring benefit of time complex-
ity of O(n). Since it is not typical, there is no need to waste time on that.

Program Creek 521 | 568


274 Longest Common Subsequence
The longest common subsequence (LCS) problem is the problem of finding the longest subsequence common to
all sequences in a set of sequences (often just two sequences).

274.1 Analysis

274.2 Java Solution

public static int getLongestCommonSubsequence(String a, String b){


int m = [Link]();
int n = [Link]();
int[][] dp = new int[m+1][n+1];

for(int i=0; i<=m; i++){


for(int j=0; j<=n; j++){
if(i==0 || j==0){
dp[i][j]=0;
}else if([Link](i-1)==[Link](j-1)){
dp[i][j] = 1 + dp[i-1][j-1];
}else{
dp[i][j] = [Link](dp[i-1][j], dp[i][j-1]);
}
}
}

522 | 568
274 Longest Common Subsequence

return dp[m][n];
}

Program Creek 523 | 568


275 Longest Common Substring
In computer science, the longest common substring problem is to find the longest string that is a substring of two
or more strings.

275.1 Analysis
Given two strings a and b, let dp[i][j] be the length of the common substring ending at a[i] and b[j].

The dp table looks like the following given a="abc" and b="abcd".

275.2 Java Solution

public static int getLongestCommonSubstring(String a, String b){

524 | 568
275 Longest Common Substring

int m = [Link]();
int n = [Link]();

int max = 0;

int[][] dp = new int[m][n];

for(int i=0; i<m; i++){


for(int j=0; j<n; j++){
if([Link](i) == [Link](j)){
if(i==0 || j==0){
dp[i][j]=1;
}else{
dp[i][j] = dp[i-1][j-1]+1;
}

if(max < dp[i][j])


max = dp[i][j];
}

}
}

return max;
}

This is a similar problem like longest common subsequence. The difference of the solution is that for this
problem when a[i]!=b[j], dp[i][j] are all zeros by default. However, in the longest common subsequence problem,
dp[i][j] values are carried from the previous values, i.e., dp[i-1][j] and dp[i][j-1].

Program Creek 525 | 568


276 LRU Cache
Design and implement a data structure for Least Recently Used (LRU) cache. It should support the following
operations: get and set.
get(key) - Get the value (will always be positive) of the key if the key exists in the cache, otherwise return -1.
set(key, value) - Set or insert the value if the key is not already present. When the cache reached its capacity, it
should invalidate the least recently used item before inserting a new item.

276.1 Analysis
The key to solve this problem is using a double linked list which enables us to quickly move nodes.

The LRU cache is a hash table of keys and double linked nodes. The hash table makes the time of get() to be
O(1). The list of double linked nodes make the nodes adding/removal operations O(1).

276.2 Java Solution


Define a double linked list.

class Node{
int key;
int value;
Node prev;
Node next;

public Node(int key, int value){


[Link]=key;
[Link]=value;
}
}

By analyzing the get and put, we can summarize there are 3 basic operations: 1) remove(Node t), 2) set-
Head(Node t), and 3) HashMap put()/remove(). We only need to define the first two operations.

526 | 568
276 LRU Cache

class LRUCache {
HashMap<Integer, Node> map = null;
int cap;
Node head = null;
Node tail = null;

public LRUCache(int capacity) {


[Link] = new HashMap<>();
[Link] = capacity;
}

public int get(int key) {


if(![Link](key)){
return -1;
}

Node t = [Link](key);

remove(t);
setHead(t);

return [Link];
}

public void put(int key, int value) {


if([Link](key)){
Node t = [Link](key);
[Link] = value;

remove(t);
setHead(t);
}else{
if([Link]()>=cap){
[Link]([Link]);
remove(tail);
}

Node t = new Node(key, value);


setHead(t);
[Link](key, t);
}
}

//remove a node
private void remove(Node t){
if([Link]!=null){
[Link] = [Link];
}else{
head = [Link];
}

if([Link]!=null){
[Link] = [Link];
}else{
tail = [Link];
}
}

Program Creek 527 | 568


276 LRU Cache

//set a node to be head


private void setHead(Node t){
if(head!=null){
[Link] = t;
}

[Link] = head;
[Link] = null;
head = t;

if(tail==null){
tail = head;
}
}
}

Program Creek 528 | 568


277 Insert Delete GetRandom O(1)
Design a data structure that supports all following operations in O(1) time.
insert(val): Inserts an item val to the set if not already present. remove(val): Removes an item val from the set if
present. getRandom: Returns a random element from current set of elements. Each element must have the same
probability of being returned.

277.1 Java Solution


We can use two hashmaps to solve this problem. One uses value as keys and the other uses index as the keys.

class RandomizedSet {
HashMap<Integer, Integer> valueMap;
HashMap<Integer, Integer> idxMap;

/** Initialize your data structure here. */


public RandomizedSet() {
valueMap = new HashMap<>();
idxMap = new HashMap<>();
}

/** Inserts a value to the set. Returns true if the set did not already contain the specified
element. */
public boolean insert(int val) {
if([Link](val)){
return false;
}

[Link](val, [Link]());
[Link]([Link](), val);

return true;
}

/** Removes a value from the set. Returns true if the set contained the specified element. */
public boolean remove(int val) {
if([Link](val)){
int idx = [Link](val);
[Link](val);
[Link](idx);

Integer tailElem = [Link]([Link]());


if(tailElem!=null){
[Link](idx,tailElem);
[Link](tailElem, idx);
}

return true;
}

return false;

529 | 568
277 Insert Delete GetRandom O(1)

/** Get a random element from the set. */


public int getRandom() {
if([Link]()==0){
return -1;
}

if([Link]()==1){
return [Link](0);
}

Random r = new Random();


int idx = [Link]([Link]());

return [Link](idx);
}
}

Program Creek 530 | 568


278 Insert Delete GetRandom O(1) Duplicates
allowed
Design a data structure that supports all following operations in average O(1) time.
Note: Duplicate elements are allowed.

insert(val): Inserts an item val to the collection.


remove(val): Removes an item val from the collection if present.
getRandom(): Returns a random element from current collection of elements.
The probability of each element being returned is linearly related to the number of same value the
collection contains.

278.1 Java Solution


This problem is similar to Insert Delete GetRandom O(1). We can use two maps. One tracks the index of the
element, so that we can quickly insert and remove. The other maps tracks the order of each inserted element, so
that we can randomly access any element in time O(1).

public class RandomizedCollection {


HashMap<Integer, HashSet<Integer>> map1;
HashMap<Integer, Integer> map2;
Random r;

/** Initialize your data structure here. */


public RandomizedCollection() {
map1 = new HashMap<Integer, HashSet<Integer>>();
map2 = new HashMap<Integer, Integer>();
r = new Random();
}

/** Inserts a value to the collection. Returns true if the collection did not already contain the
specified element. */
public boolean insert(int val) {
//add to map2
int size2 = [Link]();
[Link](size2+1, val);

if([Link](val)){
[Link](val).add(size2+1);
return false;
}else{
HashSet<Integer> set = new HashSet<Integer>();
[Link](size2+1);
[Link](val, set);
return true;
}
}

531 | 568
278 Insert Delete GetRandom O(1) Duplicates allowed

/** Removes a value from the collection. Returns true if the collection contained the specified
element. */
public boolean remove(int val) {
if([Link](val)){
HashSet<Integer> set = [Link](val);
int toRemove = [Link]().next();

//remove from set of map1


[Link](toRemove);

if([Link]()==0){
[Link](val);
}

if(toRemove == [Link]()){
[Link](toRemove);
return true;
}

int size2 = [Link]();


int key = [Link](size2);

HashSet<Integer> setChange = [Link](key);


[Link](size2);
[Link](toRemove);

[Link](size2);
[Link](toRemove);

[Link](toRemove, key);

return true;
}

return false;
}

/** Get a random element from the collection. */


public int getRandom() {
if([Link]()==0)
return -1;

if([Link]()==1){
return [Link](1);
}

return [Link]([Link]([Link]())+1); // nextInt() returns a random number in [0, n).


}
}

Program Creek 532 | 568


279 Design a Data Structure with Insert, Delete
and GetMostFrequent of O(1)
Design a data structure that allows O(1) time complexity to insert, delete and get most frequent element.

279.1 Analysis
At first, a hash map seems to be good for insertion and deletion. But how to make getMostFrequent O(1)? Regular
sorting algorithm takes nlogn, so we can not use that. As a result we can use a linked list to track the maximum
frequency.

279.2 Java Solution

import [Link].*;

class Node {
int value;
Node prev;
Node next;
HashSet<Integer> set;

public Node(int v){


value = v;
set = new HashSet<Integer>();
}

public String toString(){


return value + ":" + [Link]();
}
}

public class FrequentCollection {

HashMap<Integer, Node> map;


Node head, tail;

/** Initialize your data structure here. */


public FrequentCollection() {
map = new HashMap<Integer, Node>();
}

/**
* Inserts a value to the collection.
*/
public void insert(int val) {
if([Link](val)){
Node n = [Link](val);
[Link](val);

533 | 568
279 Design a Data Structure with Insert, Delete and GetMostFrequent of O(1)

if([Link]!=null){
[Link](val); // next + 1
[Link](val, [Link]);
}else{
Node t = new Node([Link]+1);
[Link](val);
[Link] = t;
[Link] = n;
[Link](val, t);
}

//update head
if([Link]!=null)
head = [Link];
}else{
if(tail==null||head==null){
Node n = new Node(1);
[Link](val);
[Link](val, n);

head = n;
tail = n;
return;
}

if([Link]>1){
Node n = new Node(1);
[Link](val);
[Link](val, n);
[Link] = n;
[Link] = tail;
tail = n;
}else{
[Link](val);
[Link](val, tail);
}

/**
* Removes a value from the collection.
*/
public void remove(int val) {
Node n = [Link](val);
[Link](val);

if([Link]==1){
[Link](val);
}else{
[Link](val);
[Link](val, [Link]);
}

Program Creek 534 | 568


279 Design a Data Structure with Insert, Delete and GetMostFrequent of O(1)

while(head!=null && [Link]()==0){


head = [Link];
}

/** Get the most frequent element from the collection. */


public int getMostFrequent() {
if(head==null)
return -1;
else
return [Link]().next();
}

public static void main(String[] args) {


// TODO Auto-generated method stub
FrequentCollection fc = new FrequentCollection();
[Link](1);
[Link](2);
[Link](3);
[Link](2);
[Link](3);
[Link](3);
[Link](2);
[Link](2);

[Link]([Link]());
[Link](2);
[Link](2);
[Link]([Link]());

}
}

In the implementation above, we only add nodes to the list. We can also delete nodes that does not hold any
elements.

Program Creek 535 | 568


280 Design Phone Directory
Design a Phone Directory which supports the following operations:
get: Provide a number which is not assigned to anyone. check: Check if a number is available or not. release:
Recycle or release a number.

280.1 Java Solution 1

public class PhoneDirectory {


int max;
HashSet<Integer> set;
LinkedList<Integer> queue;

/** Initialize your data structure here


@param maxNumbers - The maximum numbers that can be stored in the phone directory. */
public PhoneDirectory(int maxNumbers) {
set = new HashSet<Integer>();
queue = new LinkedList<Integer>();
for(int i=0; i<maxNumbers; i++){
[Link](i);
}
max=maxNumbers-1;
}

/** Provide a number which is not assigned to anyone.


@return - Return an available number. Return -1 if none is available. */
public int get() {
if([Link]())
return -1;

int e = [Link]();
[Link](e);
return e;
}

/** Check if a number is available or not. */


public boolean check(int number) {
return ![Link](number) && number<=max;
}

/** Recycle or release a number. */


public void release(int number) {
if([Link](number)){
[Link](number);
[Link](number);
}
}
}

536 | 568
281 Design Twitter
Design a simplified version of Twitter where users can post tweets, follow/unfollow another user and is able to
see the 10 most recent tweets in the user’s news feed. Your design should support the following methods:
postTweet(userId, tweetId): Compose a new tweet. getNewsFeed(userId): Retrieve the 10 most recent tweet ids
in the user’s news feed. Each item in the news feed must be posted by users who the user followed or by the
user herself. Tweets must be ordered from most recent to least recent. follow(followerId, followeeId): Follower
follows a followee. unfollow(followerId, followeeId): Follower unfollows a followee.

281.1 Java Solution

class Wrapper{
ArrayList<Integer> list;
int index;

public Wrapper(ArrayList<Integer> list, int index){


[Link]=list;
[Link]=index;
}
}

public class Twitter {


HashMap<Integer, HashSet<Integer>> userMap;//user and followees
HashMap<Integer, ArrayList<Integer>> tweetMap;//user and tweets
HashMap<Integer, Integer> orderMap; //tweet and order
int order; //global order counter

/** Initialize your data structure here. */


public Twitter() {
userMap = new HashMap<Integer, HashSet<Integer>>();
tweetMap = new HashMap<Integer, ArrayList<Integer>>();
orderMap = new HashMap<Integer, Integer>();
}

/** Compose a new tweet. */


public void postTweet(int userId, int tweetId) {
ArrayList<Integer> list = [Link](userId);
if(list==null){
list = new ArrayList<Integer>();
[Link](userId, list);
}
[Link](tweetId);
[Link](tweetId, order++);
follow(userId, userId);//follow himself
}

/** Retrieve the 10 most recent tweet ids in the user’s news feed. Each item in the news feed must be
posted by users who the user followed or by the user herself. Tweets must be ordered from most
recent to least recent. */
public List<Integer> getNewsFeed(int userId) {

537 | 568
281 Design Twitter

HashSet<Integer> set = [Link](userId);


if(set==null)
return new ArrayList<Integer>();

ArrayList<ArrayList<Integer>> lists = new ArrayList<ArrayList<Integer>>();

//get all users’ tweets


for(int uid: set){
if([Link](uid)!=null && [Link](uid).size()>0)
[Link]([Link](uid));
}

ArrayList<Integer> result = new ArrayList<Integer>();

PriorityQueue<Wrapper> queue = new PriorityQueue<Wrapper>(new Comparator<Wrapper>(){


public int compare(Wrapper a, Wrapper b){
return [Link]([Link]([Link]))-[Link]([Link]([Link]));
}
});

for(ArrayList<Integer> list: lists){


[Link](new Wrapper(list, [Link]()-1));
}

while(![Link]() && [Link]()<10){


Wrapper top = [Link]();
[Link]([Link]([Link]));

[Link]--;

if([Link]>=0)
[Link](top);
}

return result;
}

/** Follower follows a followee. If the operation is invalid, it should be a no-op. */


public void follow(int followerId, int followeeId) {
HashSet<Integer> set = [Link](followerId);
if(set==null){
set = new HashSet<Integer>();
[Link](followerId, set);
}
[Link](followeeId);
}

/** Follower unfollows a followee. If the operation is invalid, it should be a no-op. */


public void unfollow(int followerId, int followeeId) {
if(followerId==followeeId)
return ;

HashSet<Integer> set = [Link](followerId);


if(set==null){
return;
}

[Link](followeeId);

Program Creek 538 | 568


281 Design Twitter

}
}

Program Creek 539 | 568


282 Single Number
The problem:
Given an array of integers, every element appears twice except for one. Find that single one.

282.1 Java Solution 1


The key to solve this problem is bit manipulation. XOR will return 1 only on two different bits. So if two numbers
are the same, XOR will return 0. Finally only one number left.

public int singleNumber(int[] A) {


int x = 0;
for (int a : A) {
x = x ^ a;
}
return x;
}

282.2 Java Solution 2

public int singleNumber(int[] A) {


HashSet<Integer> set = new HashSet<Integer>();
for (int n : A) {
if (![Link](n))
[Link](n);
}
Iterator<Integer> it = [Link]();
return [Link]();
}

The question now is do you know any other ways to do this?

540 | 568
283 Single Number II

283.1 Problem
Given an array of integers, every element appears three times except for one. Find that single one.

283.2 Java Solution


This problem is similar to Single Number.

public int singleNumber(int[] A) {


int twos = 0, threes = 0;
for (int i = 0; i < [Link]; i++) {
twos |= ones & A[i];
ones ^= A[i];
threes = ones & twos;
ones &= ~threes;
twos &= ~threes;
}
return ones;
}

541 | 568
284 Twitter Codility Problem Max Binary Gap
Problem: Get maximum binary Gap.
For example, 9’s binary form is 1001, the gap is 2.

284.1 Java Solution 1


An integer x & 1 will get the last digit of the integer.

public static int getGap(int N) {


int max = 0;
int count = -1;
int r = 0;

while (N > 0) {
// get right most bit & shift right
r = N & 1;
N = N >> 1;

if (0 == r && count >= 0) {


count++;
}

if (1 == r) {
max = count > max ? count : max;
count = 0;
}
}

return max;
}

Time is O(n).

284.2 Java Solution 2

public static int getGap(int N) {


int pre = -1;
int len = 0;

while (N > 0) {
int k = N & -N;

int curr = (int) [Link](k);

N = N & (N - 1);

if (pre != -1 && [Link](curr - pre) > len) {


len = [Link](curr - pre) + 1;

542 | 568
284 Twitter Codility Problem Max Binary Gap

}
pre = curr;
}

return len;
}

Time is O(log(n)).

Program Creek 543 | 568


285 Number of 1 Bits

285.1 Problem
Write a function that takes an unsigned integer and returns the number of ’1’ bits it has (also known as the
Hamming weight).
For example, the 32-bit integer ’11’ has binary representation 00000000000000000000000000001011, so the func-
tion should return 3.

285.2 Java Solution

public int hammingWeight(int n) {


int count = 0;
for(int i=1; i<33; i++){
if(getBit(n, i) == true){
count++;
}
}
return count;
}

public boolean getBit(int n, int i){


return (n & (1 << i)) != 0;
}

544 | 568
286 Reverse Bits

286.1 Problem
Reverse bits of a given 32 bits unsigned integer.
For example, given input 43261596 (represented in binary as 00000010100101000001111010011100), return 964176192
(represented in binary as 00111001011110000010100101000000).
Follow up: If this function is called many times, how would you optimize it?
Related problem: Reverse Integer

286.2 Java Solution

public int reverseBits(int n) {


for (int i = 0; i < 16; i++) {
n = swapBits(n, i, 32 - i - 1);
}

return n;
}

public int swapBits(int n, int i, int j) {


int a = (n >> i) & 1;
int b = (n >> j) & 1;

if ((a ^ b) != 0) {
return n ^= (1 << i) | (1 << j);
}

return n;
}

545 | 568
287 Repeated DNA Sequences

287.1 Problem
All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG".
When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.
Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA
molecule.
For example, given s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT", return: ["AAAAACCCCC",
"CCCCCAAAAA"].

287.2 Java Solution


The key to solve this problem is that each of the 4 nucleotides can be stored in 2 bits. So the 10-letter-long
sequence can be converted to 20-bits-long integer. The following is a Java solution. You may use an example to
manually execute the program and see how it works.

public List<String> findRepeatedDnaSequences(String s) {


List<String> result = new ArrayList<>();
if(s==null||[Link]()<10){
return result;
}

HashMap<Character, Integer> dict = new HashMap<>();


[Link](’A’, 0);
[Link](’C’, 1);
[Link](’G’, 2);
[Link](’T’, 3);

int hash=0;
int mask = (1<<20) -1;

HashSet<Integer> added = new HashSet<>();


HashSet<Integer> temp = new HashSet<>();

for(int i=0; i<[Link](); i++){


hash = (hash<<2) + [Link]([Link](i));

if(i>=9){
hash&=mask;
if([Link](hash) && ![Link](hash)){
[Link]([Link](i-9, i+1));
[Link](hash);
}

[Link](hash);
}
}

return result;

546 | 568
287 Repeated DNA Sequences

Program Creek 547 | 568


288 Bitwise AND of Numbers Range

288.1 Given a range [m, n] where 0 <= m <= n <= 2147483647, return
the bitwise AND of all numbers in this range, inclusive. For
example, given the range [5, 7], you should return 4. Java
Solution
The key to solve this problem is bitwise AND consecutive numbers. You can use the following example to walk
through the code.

8 4 2 1
---------------
5 | 0 1 0 1
6 | 0 1 1 0
7 | 0 1 1 1

public int rangeBitwiseAnd(int m, int n) {


while (n > m) {
n = n & n - 1;
}
return m & n;
}

548 | 568
289 Sum of Two Integers
Calculate the sum of two integers a and b, but you are not allowed to use the operator + and -.
Example: Given a = 1 and b = 2, return 3.

289.1 Java Solution


Given two numbers a and b, a&b returns the number formed by ’1’ bits on a and b. When it is left shifted by 1
bit, it is the carry.
For example, given a=101 and b=111 (in binary), the a&b=101. a&b «1 = 1010.
ab̂ is the number formed by different bits of a and b. a&b=10.

public int getSum(int a, int b) {

while(b!=0){
int c = a&b;
a=a^b;
b=c<<1;
}

return a;
}

549 | 568
290 Counting Bits
Given a non negative integer number num. For every numbers i in the range 0 ≤ i ≤ num calculate the number
of 1’s in their binary representation and return them as an array.
Example:
For num = 5 you should return [0,1,1,2,1,2].

290.1 Naive Solution


We can simply count bits for each number like the following:

public int[] countBits(int num) {


int[] result = new int[num+1];

for(int i=0; i<=num; i++){


result[i] = countEach(i);
}

return result;
}

public int countEach(int num){


int result = 0;

while(num!=0){
if(num%2==1){
result++;
}
num = num/2;
}

return result;
}

290.2 Improved Solution


For number 2(10), 4(100), 8(1000), 16(10000), ..., the number of 1’s is 1. Any other number can be converted to be
2m̂ + x. For example, 9=8+1, 10=8+2. The number of 1’s for any other number is 1 + # of 1’s in x.

550 | 568
290 Counting Bits

public int[] countBits(int num) {


int[] result = new int[num+1];

int p = 1; //p tracks the index for number x


int pow = 1;
for(int i=1; i<=num; i++){
if(i==pow){
result[i] = 1;
pow <<= 1;
p = 1;
}else{
result[i] = result[p]+1;
p++;
}

return result;
}

Program Creek 551 | 568


291 Maximum Product of Word Lengths
Given a string array words, find the maximum value of length(word[i]) * length(word[j]) where the two words do
not share common letters. You may assume that each word will contain only lower case letters. If no such two
words exist, return 0.

291.1 Java Solution

public int maxProduct(String[] words) {


if(words==null || [Link]==0)
return 0;

int[] arr = new int[[Link]];


for(int i=0; i<[Link]; i++){
for(int j=0; j<words[i].length(); j++){
char c = words[i].charAt(j);
arr[i] |= (1<< (c-’a’));
}
}

int result = 0;

for(int i=0; i<[Link]; i++){


for(int j=i+1; j<[Link]; j++){
if((arr[i] & arr[j]) == 0){
result = [Link](result, words[i].length()*words[j].length());
}
}
}

return result;
}

552 | 568
292 Gray Code
The gray code is a binary numeral system where two successive values differ in only one bit.
Given a non-negative integer n representing the total number of bits in the code, print the sequence of gray
code. A gray code sequence must begin with 0.
For example, given n = 2, return [0,1,3,2]. Its gray code sequence is:

00 - 0
01 - 1
11 - 3
10 - 2

292.1 Java Solution

public List<Integer> grayCode(int n) {


if(n==0){
List<Integer> result = new ArrayList<Integer>();
[Link](0);
return result;
}

List<Integer> result = grayCode(n-1);


int numToAdd = 1<<(n-1);

for(int i=[Link]()-1; i>=0; i--){ //iterate from last to first


[Link](numToAdd+[Link](i));
}

return result;
}

553 | 568
293 UTF8 Validation
A character in UTF8 can be from 1 to 4 bytes long, subjected to the following rules:
For 1-byte character, the first bit is a 0, followed by its unicode code. For n-bytes character, the first n-bits are all
one’s, the n+1 bit is 0, followed by n-1 bytes with most significant 2 bits being 10. This is how the UTF-8 encoding
would work:

Char. number range | UTF-8 octet sequence


(hexadecimal) | (binary)
--------------------+---------------------------------------------
0000 0000-0000 007F | 0xxxxxxx
0000 0080-0000 07FF | 110xxxxx 10xxxxxx
0000 0800-0000 FFFF | 1110xxxx 10xxxxxx 10xxxxxx
0001 0000-0010 FFFF | 11110xxx 10xxxxxx 10xxxxxx 10xxxxxx

Given an array of integers representing the data, return whether it is a valid utf-8 encoding.

293.1 Java Solution

public boolean validUtf8(int[] data) {


int i=0;
int count=0;
while(i<[Link]){
int v = data[i];
if(count==0){
if((v&240)==240 && (v&248)==240){
count=3;
}else if(((v&224)==224) && (v&240)==224){
count=2;
}else if((v&192)==192 && (v&224)==192){
count=1;
}else if((v|127)==127){
count=0;
}else{
return false;
}
}else{
if((v&128)==128 && (v&192)==128){
count--;
}else{
return false;
}
}

i++;
}

return count==0;
}

554 | 568
294 Course Schedule
There are a total of n courses you have to take, labeled from 0 to n - 1. Some courses may have prerequisites,
for example to take course 0 you have to first take course 1, which is expressed as a pair: [0,1]. Given the total
number of courses and a list of prerequisite pairs, is it possible for you to finish all courses?
For example, given 2 and [[1,0]], there are a total of 2 courses to take. To take course 1 you should have finished
course 0. So it is possible.
For another example, given 2 and [[1,0],[0,1]], there are a total of 2 courses to take. To take course 1 you should
have finished course 0, and to take course 0 you should also have finished course 1. So it is impossible.

294.1 Analysis
This problem can be converted to finding if a graph contains a cycle.

294.2 Java Solution 1 - BFS


This solution uses breath-first search and it is easy to understand.

public boolean canFinish(int numCourses, int[][] prerequisites) {


if(prerequisites == null){
throw new IllegalArgumentException("illegal prerequisites array");
}

int len = [Link];

if(numCourses == 0 || len == 0){


return true;
}

// counter for number of prerequisites


int[] pCounter = new int[numCourses];
for(int i=0; i<len; i++){
pCounter[prerequisites[i][0]]++;
}

//store courses that have no prerequisites


LinkedList<Integer> queue = new LinkedList<Integer>();
for(int i=0; i<numCourses; i++){
if(pCounter[i]==0){
[Link](i);
}
}

// number of courses that have no prerequisites


int numNoPre = [Link]();

while(![Link]()){
int top = [Link]();
for(int i=0; i<len; i++){
// if a course’s prerequisite can be satisfied by a course in queue

555 | 568
294 Course Schedule

if(prerequisites[i][1]==top){
pCounter[prerequisites[i][0]]--;
if(pCounter[prerequisites[i][0]]==0){
numNoPre++;
[Link](prerequisites[i][0]);
}
}
}
}

return numNoPre == numCourses;


}

294.3 Java Solution 2 - DFS

public boolean canFinish(int numCourses, int[][] prerequisites) {


if(prerequisites == null){
throw new IllegalArgumentException("illegal prerequisites array");
}

int len = [Link];

if(numCourses == 0 || len == 0){


return true;
}

//track visited courses


int[] visit = new int[numCourses];

// use the map to store what courses depend on a course


HashMap<Integer,ArrayList<Integer>> map = new HashMap<Integer,ArrayList<Integer>>();
for(int[] a: prerequisites){
if([Link](a[1])){
[Link](a[1]).add(a[0]);
}else{
ArrayList<Integer> l = new ArrayList<Integer>();
[Link](a[0]);
[Link](a[1], l);
}
}

for(int i=0; i<numCourses; i++){


if(!canFinishDFS(map, visit, i))
return false;
}

return true;
}

private boolean canFinishDFS(HashMap<Integer,ArrayList<Integer>> map, int[] visit, int i){


if(visit[i]==-1)
return false;
if(visit[i]==1)
return true;

Program Creek 556 | 568


294 Course Schedule

visit[i]=-1;
if([Link](i)){
for(int j: [Link](i)){
if(!canFinishDFS(map, visit, j))
return false;
}
}

visit[i]=1;

return true;
}

Topological Sort Video from Coursera.

Program Creek 557 | 568


295 Course Schedule II
This is an extension of Course Schedule. This time a valid sequence of courses is required as output.

295.1 Analysis
If we use the BFS solution of Course Schedule, a valid sequence can easily be recorded.

295.2 Java Solution

public int[] findOrder(int numCourses, int[][] prerequisites) {


if(prerequisites == null){
throw new IllegalArgumentException("illegal prerequisites array");
}

int len = [Link];

//if there is no prerequisites, return a sequence of courses


if(len == 0){
int[] res = new int[numCourses];
for(int m=0; m<numCourses; m++){
res[m]=m;
}
return res;
}

//records the number of prerequisites each course (0,...,numCourses-1) requires


int[] pCounter = new int[numCourses];
for(int i=0; i<len; i++){
pCounter[prerequisites[i][0]]++;
}

//stores courses that have no prerequisites


LinkedList<Integer> queue = new LinkedList<Integer>();
for(int i=0; i<numCourses; i++){
if(pCounter[i]==0){
[Link](i);
}
}

int numNoPre = [Link]();

//initialize result
int[] result = new int[numCourses];
int j=0;

while(![Link]()){
int c = [Link]();
result[j++]=c;

558 | 568
295 Course Schedule II

for(int i=0; i<len; i++){


if(prerequisites[i][1]==c){
pCounter[prerequisites[i][0]]--;
if(pCounter[prerequisites[i][0]]==0){
[Link](prerequisites[i][0]);
numNoPre++;
}
}

}
}

//return result
if(numNoPre==numCourses){
return result;
}else{
return new int[0];
}
}

Program Creek 559 | 568


296 Minimum Height Trees
For a undirected graph with tree characteristics, we can choose any node as the root. The result graph is then
a rooted tree. Among all possible rooted trees, those with minimum height are called minimum height trees
(MHTs). Given such a graph, write a function to find all the MHTs and return a list of their root labels.
The graph contains n nodes which are labeled from 0 to n - 1. You will be given the number n and a list of
undirected edges (each edge is a pair of labels).
You can assume that no duplicate edges will appear in edges. Since all edges are undirected, [0, 1] is the same
as [1, 0] and thus will not appear together in edges.
Example 1:

Given n = 4, edges = [[1, 0], [1, 2], [1, 3]]

0
|
1
/ \
2 3
return [1]

296.1 Java Solution

public List<Integer> findMinHeightTrees(int n, int[][] edges) {


List<Integer> result = new ArrayList<Integer>();
if(n==0){
return result;
}
if(n==1){
[Link](0);
return result;
}

ArrayList<HashSet<Integer>> graph = new ArrayList<HashSet<Integer>>();


for(int i=0; i<n; i++){
[Link](new HashSet<Integer>());
}

for(int[] edge: edges){


[Link](edge[0]).add(edge[1]);
[Link](edge[1]).add(edge[0]);
}

LinkedList<Integer> leaves = new LinkedList<Integer>();


for(int i=0; i<n; i++){
if([Link](i).size()==1){
[Link](i);
}
}

560 | 568
296 Minimum Height Trees

if([Link]()==0){
return result;
}

while(n>2){
n = [Link]();

LinkedList<Integer> newLeaves = new LinkedList<Integer>();

for(int l: leaves){
int neighbor = [Link](l).iterator().next();
[Link](neighbor).remove(l);
if([Link](neighbor).size()==1){
[Link](neighbor);
}
}

leaves = newLeaves;
}

return leaves;
}

Program Creek 561 | 568


297 Graph Valid Tree
Given n nodes labeled from 0 to n - 1 and a list of undirected edges (each edge is a pair of nodes), check if these
edges form a valid tree.

297.1 Analysis
This problem can be converted to finding the cycle from a graph. It can be solved by using DFS (Recursion) or
BFS (Queue).

297.2 Java Solution 1 - DFS

public boolean validTree(int n, int[][] edges) {


HashMap<Integer, ArrayList<Integer>> map = new HashMap<Integer, ArrayList<Integer>>();
for(int i=0; i<n; i++){
ArrayList<Integer> list = new ArrayList<Integer>();
[Link](i, list);
}

for(int[] edge: edges){


[Link](edge[0]).add(edge[1]);
[Link](edge[1]).add(edge[0]);
}

boolean[] visited = new boolean[n];

if(!helper(0, -1, map, visited))


return false;

for(boolean b: visited){
if(!b)
return false;
}

return true;
}

public boolean helper(int curr, int parent,


HashMap<Integer, ArrayList<Integer>> map, boolean[] visited){
if(visited[curr])
return false;

visited[curr] = true;

for(int i: [Link](curr)){
if(i!=parent && !helper(i, curr, map, visited)){
return false;
}
}

562 | 568
297 Graph Valid Tree

return true;
}

297.3 Java Solution 2 - BFS

public boolean validTree(int n, int[][] edges) {


ArrayList<ArrayList<Integer>> list = new ArrayList<>();
for(int i=0; i<n; i++){
[Link](new ArrayList<>());
}

//build the graph


for(int[] edge: edges){
int a = edge[0];
int b = edge[1];

[Link](a).add(b);
[Link](b).add(a);
}

//use queue to traverse the graph


HashSet<Integer> visited = new HashSet<>();
LinkedList<Integer> q = new LinkedList<>();
[Link](0);

while(![Link]()){
int head = [Link]();

if([Link](head)){
return false;
}

[Link](head);

ArrayList<Integer> vList = [Link](head);


for(int v: vList){
if(![Link](v)){
[Link](v);
}
}
}

if([Link]()<n){
return false;
}

return true;
}

Program Creek 563 | 568


298 Clone Graph
Clone an undirected graph. Each node in the graph contains a label and a list of its neighbors.

298.1 Java Solution 1


In this solution,

• a queue is used to do breath first traversal,


• and a map is used to store the visited nodes. It is the map between original node and copied node.

It would be helpful if you draw a diagram and visualize the problem.

/**
* Definition for undirected graph.
* class UndirectedGraphNode {
* int label;

564 | 568
298 Clone Graph

* ArrayList<UndirectedGraphNode> neighbors;
* UndirectedGraphNode(int x) { label = x; neighbors = new ArrayList<UndirectedGraphNode>(); }
* };
*/
public class Solution {
public UndirectedGraphNode cloneGraph(UndirectedGraphNode node) {
if(node == null)
return null;

LinkedList<UndirectedGraphNode> queue = new LinkedList<UndirectedGraphNode>();


HashMap<UndirectedGraphNode, UndirectedGraphNode> map =
new HashMap<UndirectedGraphNode,UndirectedGraphNode>();

UndirectedGraphNode newHead = new UndirectedGraphNode([Link]);

[Link](node);
[Link](node, newHead);

while(![Link]()){
UndirectedGraphNode curr = [Link]();
ArrayList<UndirectedGraphNode> currNeighbors = [Link];

for(UndirectedGraphNode aNeighbor: currNeighbors){


if(![Link](aNeighbor)){
UndirectedGraphNode copy = new UndirectedGraphNode([Link]);
[Link](aNeighbor,copy);
[Link](curr).[Link](copy);
[Link](aNeighbor);
}else{
[Link](curr).[Link]([Link](aNeighbor));
}
}

}
return newHead;
}
}

298.2 Java Solution 2

public UndirectedGraphNode cloneGraph(UndirectedGraphNode node) {


if(node == null)
return null;

LinkedList<UndirectedGraphNode> queue = new LinkedList<UndirectedGraphNode>();

HashMap<UndirectedGraphNode,UndirectedGraphNode> map = new


HashMap<UndirectedGraphNode,UndirectedGraphNode>();

[Link](node);
while(![Link]()){
UndirectedGraphNode top = [Link]();
[Link](top, new UndirectedGraphNode([Link]));

for(UndirectedGraphNode n: [Link]){

Program Creek 565 | 568


298 Clone Graph

if(![Link](n))
[Link](n);
}
}

[Link](node);
HashSet<UndirectedGraphNode> set = new HashSet<UndirectedGraphNode>();
[Link](node);

while(![Link]()){
UndirectedGraphNode top = [Link]();
for(UndirectedGraphNode n: [Link]){
if(![Link](n)){
[Link](n);
[Link](n);
}
[Link](top).[Link]([Link](n));
}
}

return [Link](node);
}

Program Creek 566 | 568


299 Reconstruct Itinerary
Given a list of airline tickets represented by pairs of departure and arrival airports [from, to], reconstruct the
itinerary in order. All of the tickets belong to a man who departs from JFK. Thus, the itinerary must begin with
JFK.

299.1 Analysis
This is an application of Hierholzer’s algorithm to find a Eulerian path.
PriorityQueue should be used instead of TreeSet, because there are duplicate entries.

299.2 Java Solution

public class Solution{


HashMap<String, PriorityQueue<String>> map = new HashMap<String, PriorityQueue<String>>();
LinkedList<String> result = new LinkedList<String>();

public List<String> findItinerary(String[][] tickets) {


for (String[] ticket : tickets) {
if (![Link](ticket[0])) {
PriorityQueue<String> q = new PriorityQueue<String>();
[Link](ticket[0], q);
}
[Link](ticket[0]).offer(ticket[1]);
}

dfs("JFK");
return result;
}

public void dfs(String s) {


PriorityQueue<String> q = [Link](s);

while (q != null && ![Link]()) {


dfs([Link]());
}

[Link](s);
}
}

567 | 568
300 Pow(x, n)
Problem:
Implement pow(x, n).
This is a great example to illustrate how to solve a problem during a technical interview. The first and second
solution exceeds time limit; the third and fourth are accepted.

300.1 Java Solution

public double myPow(double x, int n){


if(n==0)
return 1;

if(n<0){
return 1/helper(x, -n);
}

double v = helper(x, n/2);

if(n%2==0){
return v*v;
}else{
return v*v*x;
}
}

568 | 568

Coding Interview in Java
Program Creek
Contents
1
Remove Duplicates from Sorted Array (https://www.programcreek.com/2013/01/leetcode-remove-duplicates-from-sorted-a
Contents
25
Shortest Word Distance III (https://www.programcreek.com/2014/08/leetcode-shortest-word-distance-iii/)
50
26
Inte
Contents
55
Isomorphic Strings (https://www.programcreek.com/2014/05/leetcode-isomorphic-strings-java/)
103
56
Two Sum (https
Contents
85
Max Sum of Rectangle No Larger Than K (https://www.programcreek.com/2014/08/leetcode-max-sum-of-rectangle-no-larg
Contents
115 Number of Connected Components in an Undirected Graph (https://www.programcreek.com/2014/05/leetcode-number-of-c
Contents
145 Intersection of Two Linked Lists (https://www.programcreek.com/2014/02/leetcode-intersection-of-two-linked-lists
Contents
175 Balanced Binary Tree (https://www.programcreek.com/2013/02/leetcode-balanced-binary-tree-java/)
337
176 Symmetri
Contents
205 Implement a Stack Using an Array in Java (https://www.programcreek.com/2015/03/implement-a-stack-using-an-array/
Contents
235 Word Pattern (https://www.programcreek.com/2014/05/leetcode-word-pattern-java/)
454
236 Word Pattern II (https:/

You might also like