I want to say a big thank you and shout out to Virology Control Studies Project Subscriber Matt Reese for sending me some of the information on this.

The previous article on the Ebola Hoax was very sizeable, being a 71 page book on its own, so for the sake of fatigue I thought I would split this up into a second part where we really flesh out the hypothesis made in the first. From the ground up, I can be very sure that any symptoms/deaths from hemorrhagic type fever, if they are confirmed to actually exist were not caused by a “contagious virus”. We have covered this part of the hoax in plenty of detail, with mountains of theoretical and experimental evidence all back up with Peer Reviewed and Published literature. But I wanted to take this one a little further by expanding upon the hypothesis I presented that if these violently quick hemorrhagic deaths were occurring they fitted an identical symptomology and speed of onset of disease more concurrent with Arsenic poisoning as well as potentially a few other Heavy Metals such as Lead, Cadmium, Cobalt and Mercury adding to the tapestry of disease (as well as what I believe to be a specificity problem within their testing too).

Another marginal reason for doing this, is that the wave of State paid actors employed to furiously shoot flak into the air as a smokescreen, simultaneously settled on a seemingly very obvious lie that Ebola patients were being tested for Arsenic poisoning.

Q: “Are Ebola cases in DR Congo being tested for Arsenic poisoning, short answer?”

Short answer: No, not as a standard or reported practice.

Ebola cases in the Democratic Republic of the Congo are investigated and tested using established public health protocols (viral PCR testing, epidemiological tracing, and sometimes testing for other common infectious causes). There is no credible evidence or official reporting that suspected Ebola cases are being routinely tested for arsenic poisoning.

If there were a poisoning concern, it would be handled separately on a case-by-case toxicology basis, not as part of Ebola diagnostics.

Of course this should be fairly self explanatory that once the medical authorities have been instructed that they are running the hoax simulation in their back yard, their immediate triage in a medical setting is to henceforth suspect anyone that complains of any ailment from sniffling noses to broken bones to bleeding out their eyes as being Ebola and so they are instantly going to reject any other cause for disease even if they share, or should I say especially if they share identical symptomology. Because here is the thing, Arsenic and Heavy Metal poisoning are very well known in Africa, especially in the mining communities, open cast mining releases all of these natural poisons into the air, soil and water as well as other poisons such as cyanide being used in the extraction process.

They are so acutely aware of this happening when the blinkers of infectious diseases are removed, that they have done country wide studies of Metalloid (Arsenic) and Heavy Metal poising in the environment as well as in people that both work and live in the mining areas. We are again going to focus in on one country to simplify the data and keep the amount of literature down, so we will stay in the area of DR Congo.

I’m listening to Heavy Metal

Abstract

In many countries, soil and water integrity is threatened by excessive accumulation of metal(loid) trace elements (MTEs), posing serious risks to human health. Despite increasing evidence of these impacts, contamination remains underrecognized in many regions due to limited data availability. This review compiles evidence on metal(loid) pollution across DRC, focusing on toxic elements such as arsenic (As), cadmium (Cd), cobalt (Co), copper (Cu), lead (Pb), mercury (Hg) and zinc (Zn), and their associated ecological impacts. Data were compiled from site-level studies and were analyzed using quantitative synthesis approaches to estimate pooled mean concentrations and identify regional differences. The findings indicate that Cu, Pb, and Cd occur at consistently high concentrations, frequently exceeding international reference values for agricultural soils. Spatial analyses reveal substantial heterogeneity, primarily driven by geological variability and inconsistencies in sampling methodologies. The Katanga Copperbelt provinces (Haut-Katanga and Lualaba) emerge as priority hotspots due to intensive mining activity, followed by Kinshasa, which also shows significant contamination levels. Nonetheless, a critical data gap remains in the eastern and northern mining zones, where soil quality and related agricultural risks are insufficiently characterized. These limitations, together with uneven spatial coverage and limited reporting of variance measures, restricts the robustness of comprehensive risk assessments. The review therefore underscores the urgent need for standardized monitoring frameworks, transparent data reporting, and region-specific policy interventions to enable evidence-based environmental management in mining-affected areas.

Mining activities are among the principal drivers of MTE contamination, as ore extraction, waste rock disposal, tailings storage, and acid mine drainage (AMD) mobilize toxic elements such as, Cd, Ni, Pb, Cu, Zn, and Hg, disrupting natural pedogeochemical balances (Dold, 2017; Fashola et al., 2016). Additional inputs arise from agricultural practices (e.g., fertilizers, sewage sludge, pesticides) and industrial and municipal sources, including fossil fuel combustion and inadequate waste management (Angon et al., 2024; Mohamed et al., 2025). While some metals (e.g., Co, Cu, Zn, Ni) are essential micronutrients, they become toxic at elevated concentrations, whereas Hg, Cd, As, and Pb are harmful even at trace levels (Jaishankar et al., 2014; Rai et al., 2019). These contaminants can bioaccumulate and biomagnify through food webs, posing serious ecological and human health risks (Bakshi et al., 2018; Angon et al., 2024; Sabir et al., 2022). Numerous studies conducted in agricultural, mining, and industrial landscapes have documented the widespread occurrence of soil contamination and its effects on higher trophic levels (Hou et al., 2025; Sabir et al., 2022; Haghighizadeh et al., 2024; Achouri et al., 2017). Worldwide, soil contamination affects over 20 million hectares and threatens more than one billion people via food chain exposure, with 14–17% of agricultural soils contaminated, particularly by Cd, Cu, and Co (Hou et al., 2025; Rodríguez-Eugenio et al., 2018; United Nations, 2015; Sanad et al., 2025). Consequently, sustainable remediation strategies, such as phytoremediation, are increasingly advocated to restore contaminated soils (Hou et al., 2020; Mohamed et al., 2025; Zhang et al., 2020; Reeves et al., 2017).

Fig. 5. Ecological risk indexes and classifications for toxic MTEs from mining sites.

Transfer from soils to plants and bioaccumulation of MTEs reported in RDC

Numerous studies in the Democratic Republic of Congo have documented the transfer of metallic trace elements (MTEs) from contaminated soils to food crops in both urban environments such as Kinshasa and mining regions including Lubumbashi and surrounding areas, raising serious concerns for food safety and public health (Kanyinda et al., 2025; Nsandji et al., 2023; Kalala et al., 2015; Mpundu et al., 2013; Langunu et al., 2023; Mputu et al., 2024; Mpundu et al., 2017; Kalonda et al., 2015; Katebe et al., 2018; Ngweme et al., 2021). Elevated concentrations of toxic metals, particularly Pb, Cd, Cu, Co, Zn, Cr, and As, have been reported in vegetables, fruits, and other food products, often exceeding FAO/WHO permissible limits and resulting in health risk indices above safety thresholds (Mputu et al., 2024; Ngweme et al., 2021). These contaminations originate from diverse sources including polluted soils, irrigation water, mining activities, traffic emissions, and agrochemical inputs (Nsandji et al., 2023; Kalala et al., 2015; Langunu et al., 2023; Katebe et al., 2018). Although several plant species exhibit metal tolerance or hyperaccumulation and show potential for phytoremediation (Reeves et al., 2017; Kanyinda et al., 2025), many edible crops such as amaranth, cassava, lettuce, spinach, and guava accumulate hazardous metal levels, highlighting the urgent need for improved soil management, remediation strategies, and environmental monitoring to protect food safety and public health (Kalala et al., 2015; Mpundu et al., 2013; Langunu et al., 2023; Katebe et al., 2018; Ngweme et al., 2021).

For consumers, chronic ingestion of contaminated crops elevates risks of cardiovascular, neurological, renal, reproductive, and carcinogenic effects linked to Cd, Pb, and As exposure (Angon et al., 2024; Rai et al., 2019; Alengebawy et al., 2021; Jomova et al., 2025). Without interventions such as pH adjustment, organic stabilization, phytoremediation, and land-use zoning to restrict cultivation in polluted areas, both agricultural sustainability and public health remain under serious threat. In this context, integrating Land Evaluation and Site Assessment (LESA) with Geographic Information Systems (GIS) can support effective land-use zoning by identifying soils suitable, marginal, or unsuitable for food production under contamination constraints (Akbari et al., 2022), an approach particularly relevant for managing the DRC’s widespread soil contamination crisis.

Therefore, the pervasive contamination of agricultural soils in the DRC represents both an ecological and public health crisis. To mitigate these risks, integrated management strategies, combining soil pH regulation, organic amendments, controlled crop selection, and regular environmental surveillance, should be prioritized. Establishing national frameworks for soil and food monitoring would not only safeguard public health but also enhance the long-term sustainability of the country’s agricultural systems.

Abstract

Introduction

Arsenic and cadmium exposures cause significant adverse effects. This study aims to determine the urinary arsenic and cadmium concentrations in men in order to analyze their profile in relation to sperm count test values.

Methods

We conducted an exposed-non-exposed analytical study of men exposed to arsenic and cadmium in a mining area in Upper Katanga, DRC and of non-exposed men living far from any mining area.

Results

Study results show that 48% of exposed subjects had semen pH below the threshold value of 7.2 versus 16% of non-exposed subjects. The risk of a lowering of pH below the standards was more than 4 times higher (OR=4.85[1.9-12.39]) among exposed men. The difference between the averages of the total number of spermatozoa was statistically significant to the advantage of non-exposed subjects. Abnormal number of spermatozoa was much higher in exposed subjects. It was recorded a more rapid spermatozoa mobility degradation in exposed subjects. In addition, 44% of exposed men had urinary arsenic concentration > 20 µg/L versus 8% of non-exposed subjects, the risk of excessive arsenic accumulation was nine times higher in exposed men than in non-exposed men (OR=9.04 [2.82-28.96]). Sixty percent of exposed men had urinary cadmium concentration ≥0.5µg/ml versus 38% of non-exposed subjects, with an Odd Ratio of 2.45 [1.1-5.47], reflecting a risk of excessive cadmium accumulation in exposed men. On the other hand, it was recorded that, among exposed men, high urinary arsenic and cadmium concentrations resulted in a proportional degradation of sperm count test values.

Conclusion

This study shows, on one hand, high urinary arsenic and cadmium concentrations and, on the other hand, more rapid and more severe alterations of sperm count test values in men living in mining area. This suggests a decline in male fertility which deserves to be further documented in future studies.

Abstract

Blood and/or urine levels of 27 heavy metals were determined by ICPMS in 41 patients with dilated cardiomyopathy (DCM) and 29 presumably healthy subjects from the Katanga Copperbelt (KC), in the Democratic Republic of Congo (DRC). After adjusting for age, gender, education level, and renal function, DCM probability was almost maximal for blood concentrations above 0.75 and 150 µg/dL for arsenic and copper, respectively. Urinary concentrations above 1 for chromium, 20 for copper, 600 for zinc, 30 for selenium, 2 for cadmium, 0.2 for antimony, 0.5 for thallium, and 0.05 for uranium, all in μg/g of creatinine, were also associated with increased DCM probability. Concurrent and multiple exposures to heavy metals, well beyond permissible levels, are associated with increased probability for DCM. Study findings warrant screening for metal toxicity in case of DCM and prompt public health measures to reduce exposures in the KC, DRC.

The blood arsenic concentration found in our subjects (0.39 µg/dL) far exceeds what has been reported in the general population of France (0.17 µg/dL) [47], Brazil (0.11 µg/dL) [50], Pakistan (0.21 µg/dL) [51], and China (0.23 µg/dL) [52]. Whether the association between DCM probability and higher blood levels of arsenic implies the later may contribute to the etiology of DCM is not known, but remains a possibility. Experimental studies in rodents, however, have demonstrated the toxic effect of arsenic on myocardial tissue through the inhibition of anti-oxidative stress defense enzymes [53,54]. Arsenic exposure has been associated with cardiopathologic effects, including ischemia, arrhythmia, and heart failure [55]. Possible mechanisms include increased oxidative stress, depletion of antioxidant status, DNA fragmentation, apoptosis by mitochondrial disruption, caspase activation, MAPK signaling and p53, functional changes in ion channels, and dyshomeostasis of trace elements [55]. It has also been revealed that arsenic can induce all kinds of diseases, including heart diseases through epigenetic modifications associated with hypermethylation of genes coding for ion channels and diverse proteins of oxidative stress and energy production [56,57].

Exposure to copper is associated with increased cardiovascular risk [58]. High copper concentrations had been associated with heart failure incidence [36,59,60,61,62,63] and bad outcomes such as re-hospitalizations and deaths over a one-year follow-up [64]. Copper is an important trace element in humans that is incorporated in several enzymes of vital functions. However, at high concentrations due to permanent exposure or in Wilson’s disease, for example, its free fraction increases in such manner that its infiltrates the myocardial tissue, induces cellular toxicity, and promotes harmful free radical formation [65,66,67,68]. Although the blood concentration of copper reported in this study was slightly higher than the upper limit of the reference value (143.7 vs. 140 µg/dL) [69], the urine concentration far exceeds levels reported as reference value [44,70] and in a very high-exposure environment [38]. This high urinary concentration, which, moreover, was strongly correlated with blood concentration (r = 0.73235, p < 0.000), was precisely such an indication of a strong recent exposure. It was also an indication of a permanent exposure to this metal, which, ironically, is the great wealth of the KC. Because of copper and cobalt, the KC has been invaded by many mining companies that are the main polluters in the region.

Abstract

Exposure to heavy metals can affect cell differentiation, neurocognitive development, and growth during early life, even in low doses. Little is known about heavy metal exposure and its relationship with nutrition outcomes in non-mining rural environments. We carried out a community-based cross-sectional study to describe the distribution of four heavy metal concentrations [arsenic (As), cadmium (Cd), lead (Pb), and mercury (Hg)] in the serum of a representative population of children aged 12 to 59 months old from the rural region of Popokabaka, Democratic Republic of Congo. The four metals were measured in 412 samples using inductively coupled plasma–mass spectrometry (ICP–MS). Limits of detection (LoD) and quantification (LoQ) were set. Percentiles were reported. Statistical and geospatial bivariate analyses were performed to identify relationships with other nutrition outcomes. Arsenic was quantified in 59.7%, while Cd, Hg, and Pb were quantified in less than 10%, all without toxicities. The arsenic level was negatively associated with the zinc level, while the Hg level was positively associated with the selenium level. This common detection of As in children of Popokabaka requires attention, and urgent drinking water exploration and intervention for the profit of the Popokabaka community should be considered.

Among the various HMs, arsenic (As), cadmium (Cd), lead (Pb), and mercury (Hg) are the most common and are considered harmful^9,10,11. Arsenic is widely distributed in natural waters, and groundwater is one of the primary routes of exposure to inorganic As¹⁵. Long-term exposure to inorganic As during infancy increases the risk of lower respiratory tract infection, gastrointestinal illnesses, and cancer^15,16. Lead, which has no physiological role in humans, is frequently found in household dust. More than 95% of the total Pb exposure ends up in the bones and teeth. Children are particularly vulnerable to lead because of its effects on growth and the developing nervous system¹⁷. Cadmium is mainly absorbed from the lungs, and tobacco smoke is one of the largest single sources of Cd exposure in humans¹⁸. It can accumulate in fatty tissues and human milk and be transferred through breast milk to children. Cadmium toxicity negatively affects reproduction, neurodevelopment, and hepatic, hematological, and immunological systems^10,18. Mercury is used in agriculture in fungicides or seed preservatives and pharmaceutical catalysts in organic syntheses. Higher levels of Hg are often found in seafood, and exposure to this element is also suspected to impair neurodevelopment in children¹² and cause dental, skin, pulmonary, and nephrotic damage¹⁹.

ANALYSIS

This is a small selection of what I could quickly find on Metalloid and Heavy Metal poisoning of people in the Democratic Republic of the Congo. This not only covers people whom work directly in the mines but indeed men, women and children in the general population. Probably the most damning evidence is when these extremely worrying levels of toxic elements are found in the urine and blood of Cardiomyopathy patients. They even go as far as to suggest causality, which to you and me shouldn’t be a surprise, but it is always good to have it confirmed by the establishments own sources. When you lay it all out on a table, that these elemental poisons are known to cause the exact palette of symptoms blamed on Ebola. They are highly prevalent in the food and water sources and found in people experiencing serious Cardio and Respiratory illness, we can see that it is an entirely plausible theory to suggest that, when and where you do have real death and disease that is being attributed to “Ebola”, it is actually far more likely it is metalloid/heavy metal poisoning instead (That and because viruses don’t exist).

But there is one slight issue with this theory, in the realms of the “negative” case for “Ebola” but the “Positive” case for areas of increased Metalloid/Heavy Metal contamination. I started this part 2 from a Ghanian report of Arsenic poisoning and its effects that Matt sent me (https://scitechjournals.com/articles/ecological-study-of-galamsey-activities-in-ghana-and-their-physiological-toxicity.pdf).

Please read it when you have the time as it is absolutely damning. Indeed this whole area of research is a literal gold mine of industrial harms perpetrated either directly or indirectly by the globalist operators in Africa. But the problem for me, personally with this particular article is that it doesn’t really match up with my theory in that Ghana has never had a claimed “ebola” outbreak. Now there is some wiggle room here in the fact that Ghana has seen a claimed “Marburg” outbreak in 2022 and Marburg is the identical hoax where the “Viruses” particles are identical, the symptoms are identical so we could “get away” with just continuing on oblivious. But I want to be a bit circumspect here and finish this hoax off with the final layer of the puzzle.

MONOCLONAL ANTI(Human)Bodies

Ebola-specific drugs (used once confirmed or strongly suspected in outbreak settings)

If Ebola is confirmed (or in some outbreak protocols when suspicion is very high), monoclonal antibody therapies are used:

• Inmazeb (atoltivimab/maftivimab/odesivimab)
  → A 3-antibody cocktail targeting the Ebola virus

• Ebanga (ansuvimab-zykl)
  → Single monoclonal antibody treatment

These are the main WHO-recommended treatments for Zaire ebolavirus disease.

4) Experimental/older treatments (less used now)

• ZMapp (older monoclonal antibody cocktail, largely replaced)

• Remdesivir (studied but not a standard Ebola therapy)

• Other antivirals have generally not shown strong benefit compared to antibody therapies

More than 11 years ago, six young men were left writhing in agony with their organs failing after agreeing to take part in a routine drugs trial in London.

The group were part of a team of eight who were each offered £2,000 for a three-day trial that would potentially help revolutionize cancer treatment.

The men, who had been selected to be aged between 19 and 34, had been told the worst symptoms would be a headache, nausea and, in rare cases, hives.

However, soon after receiving the drug, six were left vomiting and screaming in agony – with one having to have body parts amputated.

Now, a BBC documentary has revisited the dramatic events that left the human guinea pigs fighting for their lives in a private unit at Northwick Park Hospital in north-west London run by Parexel, a US company.

Throughout the Phase 1 trial, a number of the men suffered from swelling – with their heads inflating like balloons.

One of the victim’s family said he looked like ‘the Elephant Man’, which led to the TGN1412 legal proceedings’ nickname, ‘the Elephant Man drug trial’ – although the swelling was likely caused by the treatment for the reaction, which included administering large quantities of fluid and steroids.

The drug, which had been successfully tried out on monkeys, had never been tested on humans, making it a ‘first in man’ trial. It was later found that while macaques and humans are incredibly close from a DNA perspective, the cells that the drug targeted differ slightly between the species.

The incident quickly transformed into one of Britain’s most infamous medical emergencies.

Fortunately, doctors were able to save the lives of all of the young men – and a few weeks later, five of the men were able to leave hospital, however, the drug had attacked their tissue and left them with wasted muscles. One, David Oakley, said it had left him feeling like ‘an 80-year-old’.

Ryan Wilson, the sixth and youngest participant aged 21, spent the next four months being treated for heart, liver and kidney failure.

Sections of his feet were amputated and his fingertips also fell off.

It was later revealed that two of the participants were given a placebo and did not suffer the effects.

In the documentary, The Drugs Trial, which aired last night, doctors speak about the struggles they faced while attempting to bring the ‘mysterious’ situation under control.

Investigators also reveal that they were sent in and tasked with finding out what went wrong at the trial on March 13, 2006. They found that Parexel could not have known the ‘unpredictable’ biological reaction would occur, although the risk of cytokine storm – the effect that caused the reaction – was mentioned in Parexel’s own literature with the recommendation to treat with steroids.

Participant Raste Khan, who was 23 at the time and had been given a placebo, said: ‘Medical trials were like a get-rich-quick scheme. It was a no brainer.

‘It was all manic, everything was happening all at once. They were vomiting, they were screaming in pain, people were fainting, they couldn’t control their bowels… it was like a horror movie.’

In the documentary, it was revealed that families were told to say goodbye to their loved ones as they may be about to die.

Since the disaster, all six men have received undisclosed pay-outs from Parexel in private out-of-court settlements.

A report published by The Medicines & Healthcare Products Regulatory Agency in April 2006 had 22 recommendations to improve the safety of future Phase 1 trials, including that individuals given a ‘first in man’ drug in a trial should not receive the drug at the same time on the same day and high risk trials should take place in a hospital with access to intensive care.

The new recommendations have now been adopted across the whole of Europe.

Trial lead Dr Bradford, who had worked on 300 clinical trials before this one, said he has never worked on a trial of this nature again. ‘It was the last ‘first in man’ trial I did,’ he says. ‘I’d like to look them in the eye and say sorry.’

Trial participant David Oakley was found to have pre-cancer signifiers in his blood after the trial that may or may not have pre-dated the trial.

He married his fiancee months later but feared he could be left infertile. However, 10 years on, he has three children and no sign of cancer or other lasting effects. He now says: ‘I was unlucky. But it didn’t kill me, and that’s pretty good. Having my first child with the chance that we might not have been able to have kids, made it even more special.

‘Medical trials are very important to advance our knowledge of medicine. It’s only when you have a relative who’s sick and depends on drugs that have been through human trial that you understand how important it is that they are carried out.’

In 2013, TGN1412 was tested again in human trials in Russia under the new name, TABO8. The amount was 0.1% of the amount injected into the participants of the Parexel trial and it was infused 40 times more slowly.

The drug could still be used as a treatment for autoimmune disease in the future.

Q: Inmazeb (atoltivimab/maftivimab/odesivimab) have these got any bad known side effects?

Yes — Inmazeb (atoltivimab/maftivimab/odesivimab) does have known side effects, but most are tied more to infusion reactions and the severity of Ebola illness itself rather than “toxic drug effects” in the way some chemotherapy drugs behave.

Here’s the clean breakdown.

---

Most common side effects

In clinical studies, the most frequently reported effects (seen in ≥20% of patients) include:

• Fever (pyrexia)

• Chills / shivering

• Fast heart rate (tachycardia)

• Fast breathing (tachypnea)

• Vomiting

These often overlap with Ebola symptoms themselves, which makes interpretation tricky.

---

Infusion-related reactions (most clinically important risk)

Because it’s an IV monoclonal antibody, the main concern is infusion or hypersensitivity reactions, which can include:

• Sudden fever or chills during infusion

• Low blood pressure

• Shortness of breath

• Rash or itching

• Dizziness or fainting

• Rarely, severe or life-threatening allergic-type reactions

These are why patients are:

• monitored closely during infusion

• treated in high-acuity hospital settings

ANALYSIS

One of the treatments for Ebola is using that well known kidney melting drug Remdesivir, so we don’t really need to waste much time explaining the problem here. I really want to focus on the use of Monoclonal Antibodies as the “got to “ for confirmed Ebola patients. Looking at the “Elephant Men” drugs trial where they gave IV Monoclonal Antibodies that was supposed to “cure” Leukemia, i.e a blood cancer, these men in the trial very quickly started extreme bouts of vomiting, diarrhea, migraine, loss of consciousness and coma. This as they note was brought about by what they call a “Cytokine Storm” where the body floods itself with what the medical establishment believe is “immune cells” and eventually causes multiple organ failure .

The most stunning part to this story, and I really would recommend watching the BBC documentary on it if you want another example of Big Pharma and the Medical Industry’s ongoing genocide, is that this drug that almost killed the 6 men given it, was released back onto the market! They changed the made up acronym from TGN1412 to TAB08 and then used it at 0.1% concentration. Jaw-dropping really, but when you realize that the entire allopathic death cult is predicated on giving people little bits of poison until they either get better on their own despite the poison for the disease to come again soon or die from the poison.

Finally when we looked at the specific Monoclonal Antibodies used for Ebola, funnily enough they outright admit that the known side effects exactly match Ebola symptoms which makes “interpretation tricky”. Well yes indeed it would make it tricky if the drug you were giving people were causing the symptoms you are giving the drug for, that’s kind of where we are on this House-of-Horrors-Roundabout-Groundhog-Day-Purgatory we find ourselves burdened with when it comes to navigating the “health”care industries.

“EBOLA” Patient Dr. Ian Crozier

I want to leave you with the story from the mouth of a claimed “Ebola” survivor, Dr . Ian Crozier. Because this is going to be put into Ebook format that doesn’t have video embedded into it, I would urge you watch the full video here.

There are a couple of absolute zingers I want to point out to you from this testimony. Ian has very basic low grade symptoms of a fever, muscle aches and a headache, which could be interpreted as basically any disease in the entire smorgasbord of relabeling detoxing. The “emergency” situation was not brought about by symptoms at all, but would you know it was entirely started by a Positive PCR test (huge eye roll). Ian recounts this next phase in quite a bit of detail (because it is the last thing he remembers) that he was, in his own words, “clearheaded” and “fairly well”. However the moment he crossed the drawbridge into the Medical Dungeon was the moment it all seemed to go pear shaped (color me shocked I tell you). He developed severe gastrointestinal symptoms, vomiting and diarrhea, then a Cytokine Storm bringing about multiple organ failure.

Now, I mean called me cynical, but this man in his own words was “fairly well” and then displayed the identical symptoms of what can only be described as Monoclonal Antibody poisoning directly mirroring the poisoning of the “Elephant Men”. I hope you can see very clearly what is occurring here, well people with generic symptoms are being systematically maimed and killed with proven lethal chemical cocktails based on a PCR test and politics.

If you have enjoyed this article and want to support the project with a one time donation please BuyMeACoffee, thanks!

This article is available as a downloadable EBook along with the rest of my work on ShadowBanned Library

This fake “virus” is an absolute firm favorite of the wibbles on the internet who have an enduring infatuation with the Germ Theory. If you don’t know the type by now, I will share my near daily experience of dealing with these bottom feeders for now more than half a decade (genuinely feels like only yesterday right? ).

The story goes a little like this: I put out a piece of peer reviewed science that completely contradicts the narrative of some part of the Germ Theory or Genetics. Germ Theory Enthusiast arrives on the scene at an inhumanely quick pace and either has a completely unprovable anecdote fitting the exact method that contradicts the science I presented OR jumps straight into death threat mode: “If germs aren’t real then why don’t you inject yourself with Ebola? Hahaha”. The Ebola part to that is where these agent provocateurs think they have been really smart, as people might agree to a bought of da “Flu” but nobody in their right mind would “risk” it with bleeding out the eyes with “Ebola”. It serves as the biggest scariest monster under the bed, the Top Trump on the list of Boogiemen to play when making their online threats.

Just to make this public for people whom have encountered this online, I will point out that this is a threat and is considered a serious crime in the US and EU. A person making a bet or encouraging people to inject themselves with what they believe will kill or seriously injure someone is a direct intent to encourage suicide or serious harm and carries a prison sentence of up to 10 years. So these trolls that think they are being funny or proving a point are actually committing a crime and will be reported for doing as such.

I don’t really need to explain myself, but I will anyway, the reasons why I won’t be partaking in any injections, of anything:

A. To prove or disprove Contagion you have to use a method that is a claimed natural pathway, there is no natural pathway that comes from a hypodermic needle being thrust intravenously.

B. These Contagion studies have been done for 200 years, experimenting with all of these claimed “viruses” and have never managed to make anyone sick with the claimed disease caused, all documented for anyone to read.

C. Injecting anything, even saline comes with its own set of hazards, and can actually induce cold and flu like symptoms as seen in many control groups in contagion studies and outlined experimentally below. The body is not used to having anything directly entering the bloodstream before it has been digested, broken down and filtered first. “Chemically” it is going from 0-100 almost instantaneously which is why it is the ultimate hit for drug abusers and usually ends fairly quickly once this stage of abuse is reached (The ultimate way to throw your body out of balance).

D. In the claimed “viral” isolates are plenty of noxious chemicals especially in the antibiotics area. Listed below are all of the ingredients in the cell culture, only 5/23 ingredients not being considered toxic to humans. Once again, injecting any of these things comes with potential harms.

• Water

• Sodium chloride (NaCl) — generally safe at culture concentrations

• Potassium chloride (KCl) — harmful in high doses

• Calcium chloride (CaCl₂) — irritant in concentrated form

• Magnesium sulfate (MgSO₄) — low toxicity

• Sodium bicarbonate (NaHCO₃) — low toxicity

• Sodium phosphate (NaH₂PO₄) — low toxicity

• Glucose (D-glucose) — safe nutrient

• Sodium pyruvate — low toxicity

• HEPES buffer — low toxicity, lab irritant possible

• Phenol red — possible endocrine activity in some studies; irritant in concentrated form

• L-glutamine — low toxicity

• Essential amino acids (lysine, leucine, valine, tryptophan, etc.) — generally safe nutrients

• Non-essential amino acids (serine, glycine, alanine, etc.) — generally safe

• Vitamins (thiamine, riboflavin, folic acid, niacinamide, choline, inositol, etc.) — generally safe at culture concentrations

• Trace iron/nitrates — irritant/toxic at high concentrations

• Fetal bovine serum (FBS) — biological material; contamination/allergy/infectious-agent risk possible

• Penicillin — allergy risk in humans

• Streptomycin — ototoxic/nephrotoxic at systemic doses

• Amphotericin B — significantly toxic systemically

• Gentamicin — nephrotoxic/ototoxic

• Trypsin-EDTA (used during passaging) — corrosive/irritant to tissue

• Antibiotic-antimycotic mixes — variable toxicity depending on components

E. Just viscerally I do not inject things into my body. Even if nobody had ever come to any harm from injection and you could somehow prove it, injecting stuff into ones body is for junkies, tramps, degenerates and people who believe in “Viruses” (Same thing alert). In the animal kingdom, injection through breaking the flesh is ONLY done by things looking to do harm, or seriously deter such as snakes, spiders, scorpions etc etc. They do this, as above, because their venom has the most possible chance of doing damage which is why such tiny creatures with such small amounts of poison can be so injurious to animals much bigger.

They distilled water, i.e made it completely sterile and with its injection produced fever and cold like symptoms in rabbits. But then somehow concluded that despite being distilled, still contained a pathogenic agent. Germ Theory Idiocy strikes once again.

EBOLA IS A HOAX

Sorry for that little detour, I think some of those things had to be put in an article at some point and was feeling a little zesty. Back to the millstone:

The first thing I want to point out is quite esoteric, it is not something that I really want to descend too far down the road with “evidence” based reasoning as largely it meanders down the wormhole of GeNEtICs and PrOtEOmIcs which in totality is a made up fairytale, so it would be extremely tedious. But one thing that is very apparent to me is that the claim is there are 1.67m distinct species of “virus” (Lol) and they range from being claimed to be endogenous to humans (I.e present at all times in our “genome”) right the way through to piss out your kidney and bleed out your ears in under 24 hrs with Ebola and everything in between.

The length of the claimed Viral Genomes which is all a “virus” is, a claimed string of 4 different nucleotides varies from around 1kb to 2.5mb whereby the length of the genome has absolutely nothing to do with its claimed pathogenicity. They claim that only small sections of these (genes) which code for “proteins” actually carry out the pathogenicity. This “pathogenicity” as we have seen ranges from nothing to dead in days, so really what they are claiming is that depending on what order you write 4 letters depends on whether you live or die…..

atcgtgtattatgcggcgatcgtacggtatg : That one is fine, that encodes for a “protein” that just does nothing.

ctactacggatgtttagaccaacgtcattcgc: That one encodes for a “protein” that liquifies your liver.

As I say I will spare you the magic roundabout that any investigation goes on in this area because all of the Science is based purely on a “trust me bro” basis. When it comes to pathogenicity they push everything into the realms of proteomics where it is just harmless or deadly, once again going down some rabbit hole of molecular chemistry with zero explanation or evidence about how or why it happens other than “it does happen” and we invented a story to fill in the gaps.

So my overarching point is the absurdity of claiming that the way 4 different claimed molecules are “ordered” is literally life or death, this should go to the same thinking as “genetic” and “Oncological” diseases and the general notion that the human body can and will attack itself. One of the most absurd lies in medical “science” that all of a sudden for no particular reason your insides just decide to kill themselves and take you with them. It is clear that this kind of thinking is just more of an insurance policy for industrial and medical harms.

The Numbers

Q: Are the vast majority of Ebola deaths in Africa? Can you give me a breakdown by country over time, please.

Yes — and very overwhelmingly so. Nearly all recorded deaths from Ebola virus disease have occurred in Africa.

Here’s a concise breakdown by major outbreaks and countries over time (rounded figures):

🕰️ 1976–1990s (first outbreaks)

• Democratic Republic of the Congo (then Zaire)

  • ~280 deaths (1976 outbreak)

• Sudan

  • ~150 deaths (1976 outbreak)

👉 Early outbreaks already concentrated in Central/East Africa

🕰️ 2000–2013 (sporadic outbreaks)

• Uganda

  • ~224 deaths (2000 outbreak)

• Republic of the Congo

  • ~200+ deaths across multiple outbreaks

• Gabon

  • ~150+ deaths

👉 Still entirely African, mostly Central Africa

🕰️ 2014–2016 (largest epidemic ever)

West Africa epidemic:

• Liberia

  • ~4,800 deaths

• Sierra Leone

  • ~4,000 deaths

• Guinea

  • ~2,500 deaths

Total: ~11,300 deaths

👉 This single epidemic accounts for most Ebola deaths in history

🕰️ 2018–2020 (DRC outbreak)

• Democratic Republic of the Congo

  • ~2,300 deaths

🕰️ 2020s (recent smaller outbreaks)

• DRC, Uganda, Guinea

  • Typically tens to hundreds of deaths per outbreak

🌍 Outside Africa (very rare)

• A few isolated cases in:

  • United States

  • Spain

• Deaths outside Africa: extremely few (single digits)

📊 Big picture

• Total Ebola deaths (all time): ~15,000+

• In Africa: >99.9%

• Outside Africa: negligible

🔑 Bottom line

👉 Ebola is almost entirely geographically confined to Africa, both in outbreaks and deaths, with the 2014–2016 West Africa epidemic dominating the global total.

The reason almost all deaths from Ebola virus disease occur in Africa isn’t one single factor—it’s a combination of ecology, exposure, and public health response.

🦇 1. Natural reservoir is in Africa

• Ebola is believed to be maintained in fruit bats (especially African species)

• These animals live in Central and West Africa, so spillover events start there

👉 No reservoir elsewhere → no sustained outbreaks elsewhere

Q: What other countries around the world have fruit bats?

Fruit bats (family Pteropodidae, often called flying foxes) are actually widespread across the tropics, not just Africa.

❌ Where they are NOT found

• Europe (native populations absent)

• Most of North America

• Most of South America

👉 These regions have bats, but not fruit bats (Pteropodidae)

🧠 Key takeaway

Fruit bats live across Africa, Asia, and Oceania, meaning:

• The presence of these animals alone does not explain Ebola outbreaks

• Other ecological and epidemiological factors matter too

Really we don’t need to go much further with our investigation here. In totality even the mainstream admit that it is the Terrain that makes the disease. Ebola is ONLY found in Africa, they claim it comes from a Fruit bat and people eating bushmeat, i.e eating bats (where have we seen that one before lol ). Yet Fruit bats are native to everywhere else in the entire world apart from Europe and the Americas. Once again, to point this out they claim that eating bat soup in Wuhan gives you a runny nose, but eating a bat in Uganda dissolves your kidneys. They strangely regard eating Fruit bat as a traditional delicacy in Samoa and Papua New Guinea. Just by sheer logic, if eating these things did make some tribes people (but not all obviously PMSL) piss out their kidneys and bleed out their eyes, one would have thought that they might have replaced the “Christmas bat” with something slightly less dangerous. So logic dictates that the “zoonotic” theory is bunkum obviously and everything points to this being a geographical problem specific to Africa.

EBOLA On My Mined

Q: All of the countries that have ever experienced an Ebola outbreak, are they all countries that have mining activities in them?

Countries with Ebola Outbreaks .

Ebola (various species like Zaire/EBOV, Sudan/SUDV, Bundibugyo/BDBV, and Taï Forest) has primarily affected Central and West Africa since 1976, with most cases in forested or rural areas linked to wildlife (e.g., fruit bats). Key countries with local/autochthonous outbreaks or transmission include:

en.wikipedia.org

• Democratic Republic of the Congo (DRC): Multiple outbreaks; heavily affected.

• Guinea, Liberia, Sierra Leone: Major 2014–2016 West Africa outbreak.

• Uganda: Several outbreaks.

• Gabon, Republic of the Congo: Multiple.

• South Sudan (formerly Sudan): Early outbreaks.

• Ivory Coast (Côte d’Ivoire): Taï Forest virus case.

• Others with smaller/local transmission: Nigeria, Mali, Senegal, South Africa.

Imported or limited cases (often single patients or short chains, no sustained outbreak) occurred in: Italy, Spain, UK, US, Philippines, Russia, and others.

mercycorps.org

Mining Activities in These CountriesVirtually all African countries with local Ebola transmission have active or historical mining (industrial, artisanal/small-scale). Africa is rich in minerals, and many Ebola-affected areas overlap with mining zones (e.g., gold, diamonds, iron ore).

en.wikipedia.org

• DRC: Major global producer of cobalt, copper, diamonds, gold; outbreaks have occurred in/near mining areas (e.g., gold mining villages).

  abcnews.com

• Guinea, Liberia, Sierra Leone: Significant iron ore, gold, diamonds, bauxite; mining was impacted but continued during the 2014–2016 outbreak.

  pmc.ncbi.nlm.nih.gov

• Gabon, Republic of the Congo: Oil, manganese, gold, timber-related extraction; historical gold-mining camp outbreaks.

  en.wikipedia.org

• Uganda: Gold, copper, and other minerals; artisanal mining present.

• South Sudan: Gold, copper, iron ore, limestone; artisanal gold mining is active and economically important.

  en.wikipedia.org

• Ivory Coast: Gold (major producer), diamonds, manganese, bauxite, nickel; growing formal and informal sector.

  en.wikipedia.org

• Mali, Nigeria, Senegal: Gold (Mali is a top African producer), plus other minerals.

Here we see that every single place that has experienced an “Ebola” outbreak is also an area of heavy mining and exploitation of raw earth materials. Africa has throughout the 19th and 20th Centuries been the playground of the Colonialists looking to exploit the locals for slave labor and the land for its natural resources, take back as plunder to the West. I want to chose the country in the news as the latest “Ebola” outbreak to focus in on just so we don’t spread ourselves too thinly and can deeply analyze it, being the Democratic Republic of the Congo ( sounds very official doesn’t it). We will see later on that the exploits of the colonizers has never really ceased, they just do it remotely now.

Rumble In The Jungle

The reign of Leopold II of Belgium in Central Africa (roughly 1885–1908) is widely regarded as one of the most brutal colonial regimes in history.

Leopold didn’t rule the Congo as a Belgian colony at first—he personally owned it as the Congo Free State, established after the Berlin Conference. He presented his rule as humanitarian and anti-slavery, but in reality it became a system of extreme exploitation.

The main goal was profit, especially from rubber and ivory. To maximize extraction, Leopold’s agents imposed strict quotas on Congolese villages. If people failed to meet them, they faced horrific punishments: beatings, hostage-taking, mutilation (most notoriously cutting off hands), and execution. These acts were often carried out by a colonial army called the Force Publique.

The human toll was staggering. While exact numbers are debated, historians estimate that millions of Congolese people died due to violence, forced labor, starvation, and disease during Leopold’s rule.

International outrage grew in the early 1900s, fueled by activists like E. D. Morel and Roger Casement, who exposed the abuses. Under mounting pressure, Leopold was forced in 1908 to hand control of the territory to the Belgian government, ending his personal rule.

In short: Leopold II’s Congo regime was built on forced labor, terror, and mass death—leaving a legacy that still shapes perceptions of colonialism today.

Smartphones, computers and electric vehicles may be emblems of the modern world, but, says Siddharth Kara, their rechargeable batteries are frequently powered by cobalt mined by workers laboring in slave-like conditions in the Democratic Republic of Congo.

Kara, a fellow at Harvard’s T.H. Chan School of Public Health and at the Kennedy School, has been researching modern-day slavery, human trafficking and child labor for two decades. He says that although the DRC has more cobalt reserves than the rest of the planet combined, there’s no such thing as a “clean” supply chain of cobalt from the country. In his new book, Cobalt Red, Kara writes that much of the DRC’s cobalt is being extracted by so-called “artisanal” miners — freelance workers who do extremely dangerous labor for the equivalent of just a few dollars a day.

“You have to imagine walking around some of these mining areas and dialing back our clock centuries,” Kara says. “People are working in subhuman, grinding, degrading conditions. They use pickaxes, shovels, stretches of rebar to hack and scrounge at the earth in trenches and pits and tunnels to gather cobalt and feed it up the formal supply chain.”

Kara says the mining industry has ravaged the landscape of the DRC. Millions of trees have been cut down, the air around mines is hazy with dust and grit, and the water has been contaminated with toxic effluents from the mining processing. What’s more, he says, “Cobalt is toxic to touch and breathe — and there are hundreds of thousands of poor Congolese people touching and breathing it day in and day out. Young mothers with babies strapped to their backs, all breathing in this toxic cobalt dust.”

National

In Idaho, America’s first, and only, cobalt mine in decades is opening

Cobalt is used in the manufacture of almost all lithium ion rechargeable batteries used in the world today. And while those outside of the DRC differentiate between cobalt extracted by the country’s high-tech industrial mining companies and that which was dug by artisanal miners, Kara says the two are fundamentally intertwined.

“There’s complete cross-contamination between industrial excavator-derived cobalt and cobalt dug by women and children with their bare hands,” he says. “Industrial mines, almost all of them, have artisanal miners working, digging in and around them, feeding cobalt into the formal supply chain.”

Sponsor Message

Kara acknowledges the important role cobalt plays in tech devices and in the transition to sustainable energy sources. Rather than renouncing cobalt entirely, he says people should focus on fixing the supply chain.

“We shouldn’t be transitioning to the use of electric vehicles at the cost of the people and environment of one of the most downtrodden and impoverished corners of the world,” he says. “The bottom of the supply chain, where almost all the world’s cobalt is coming from, is a horror show.”

Some 20,000 people work at Shabara artisanal mine in the DRC, in shifts of 5,000 at a time. The DRC produced approximately 74% of the world’s cobalt in 2021.

Junior Kannah/AFP via Getty Images

Interview Highlights

On how “artisanal” cobalt mines continue to operate in the DRC — despite being illegal

Technically, under the law, there should not be artisanal mining taking place in any industrial mine. And yet, lo and behold, at most of the industrial mines, there is some artisanal mining taking place. In some cases, predominantly artisanal mining is taking place. And the reason is, it’s a penny-wage way to boost production. I mean, imagine you’re in a part of the world where there are millions of people who barely get a dollar or two a day who are grindingly poor and will accept almost any labor arrangement just to survive. Well, you put them in a tight pit, cram them with 10,000 other people and pay them a couple of dollars, and they’ll produce thousands of tons of cobalt per year for almost no wages. And so that’s not legal, but it’s happening.

On why these conditions are on par with slavery

Imagine an entire population of people who cannot survive without scrounging in hazardous conditions for a dollar or two a day. There is no alternative there. The mines have taken over everything. Hundreds of thousands of people have been displaced because their villages were just bulldozed over to make place for large mining concessions. So you have people with no alternative, no other source of income, no livelihood. Now, add to that the menace in many cases of armed forces pressuring people to dig, parents having to make a painful decision, ‘Do I send my child to school or do we eat today?’ And if they choose the latter, that means bringing all their kids into these toxic pits to dig just to earn that extra fifty cents or a dollar a day, that could mean the difference between eating or not. So in the 21st century, this is modern-day slavery. It’s not chattel slavery from the 18th century where you can buy and trade people and own title over a person like property. But the level of degradation, the level of exploitation is on par with old-world slavery.

An artisanal miner holds a cobalt stone at the Shabara artisanal mine in the DRC.

Junior Kahhah/AFP via Getty Images

On the danger of collapse in artisanal mines

I spoke with many families whose children, husbands, spouses, had suffered horrific injuries. Oftentimes, digging in these larger open-air pits, there are pit wall collapses. Imagine a mountain of gravel and stone just avalanching down on people, crushing legs and arms, spines. I met people whose legs had been amputated, who had metal bars in where their legs used to be. And then the worst of all is what happens in tunnel digging. There are probably 10,000 to 15,000 tunnels that are dug by hand by artisanal miners. None of them have supports, ventilation shafts, rock bolts, anything like that. And these tunnels collapse all the time, burying alive everyone who is down there, including children. It's a demise that is almost impossibly horrific to imagine. And yet I met mothers pounding their chests in grief, talking about their children who had been buried alive in a tunnel collapse. And these stories never get out of the Congo. People just don't know what's happening down there.

Sponsor Message

On the trafficking of children to work in the mines

MacMillan

There's money to be made in every corner and every direction. And you've got these militias. Sometimes they're called commandos and they will abduct children, traffic children, recruit children from even other parts of the Congo. I met children who had come from hundreds of miles away and have been brought through militia networks down into the copper cobalt mines to dig. And as they dig and earn their dollar or two, that's what funds these militia groups. So children are the most heavily exploited of all the people down there. They're the most vulnerable and oftentimes trafficked and exploited in some cases in very violent circumstances.

On government corruption preventing change

Corruption is a big part of the problem. That's what allows so much of this abuse to persist. And the thing is, imagine the Congo. It's a war-torn, deeply impoverished nation that has been subjected to generations of pillage and ransacking going all the way back, now centuries, to the slave trade. And so when big foreign stakeholders come waving around large sums of money, it's not a long stretch of the imagination to see that there would be corruption. ...

World

Belgium returned a single tooth to the Congo this week. Here’s why

The first democratically elected president of the Congo [in 1960], Patrice Lumumba, made a pledge that the country's immense mineral riches and resources would be used for the benefit of the people who live there. And in short order, within six months, he had been deposed, assassinated, chopped to pieces, dissolved in acid and replaced with a bloody dictator, a corrupt dictator who would keep the minerals flowing in the right direction. So if you don't play ball with the power brokers at the top of the chain and with the Global North, Patrice Lumumba showed what's the outcome, what will happen. And I think that's also a part of this lesson that we need to understand historically, when we talk about things like corruption.

On how China came to own most of the industrial mines in the Congo

China cornered the global cobalt market before anyone knew what was happening. It goes back to the year 2009 under the previous president in the Congo,

The 33rd Element

You know how they like to leave their calling card with these hoaxes, well this one is really quite in your face. Outlined above is the appalling slavery of past and present that is quite obviously hazardous to human life, endangering the men, women and children forced either directly or indirectly ( because globalist corporations have mechanized the process elsewhere pushing more artisanal mining to occur to be able to keep up with the wealth disparity of inevitable inflation).

One thing that none of the news articles really seem to touch upon is the massive release of naturally occurring toxins, poisons and heavy metals released into the environment, waterways and air but also the vast amount of toxic chemicals that are used in the mining process itself. One of those that is very frequently occurring is Arsenic, which just so happens to be atomic number 33, the 33rd element in the periodic table (Huge Eye Roll). It is going to be the element we focus in on in this article, but for sake of clarity there are MANY MANY others involved and released in the mining activates including mercury, lead, manganese and cyanide.

🧱 1) Toxic elements released from the earth (naturally present in ores)

6

These are often locked in rock and become dangerous when mining exposes and processes them:

Heavy metals & metalloids

• Arsenic

• Lead

• Mercury

• Cadmium

• Chromium (especially toxic Cr(VI))

• Nickel

• Copper (toxic at high levels)

• Cobalt (can cause lung/heart issues)

• Manganese (neurological toxicity)

Radioactive elements (sometimes present)

• Uranium

• Thorium

What happens:

When exposed to air and water, these can form acid mine drainage and leach into rivers, soil, and drinking water.

⚗️ 2) Toxic chemicals used in gold mining

4

Main extraction chemicals

• Sodium cyanide

• Potassium cyanide
  👉 Used in cyanide leaching to dissolve gold

• Mercury
  👉 Used in artisanal mining to form gold amalgam (very dangerous)

Other associated chemicals

• Sulfuric acid

• Nitric acid

• Hydrochloric acid
  👉 Used in refining and ore treatment

• Lime (to control pH, but still reactive)

🔋 3) Toxic chemicals used in cobalt & copper mining

6

Cobalt is usually extracted alongside copper using hydrometallurgy:

Strong acids

• Sulfuric acid (the most common)

Solvent extraction chemicals

• Organic solvents (e.g., kerosene-based mixtures)

• Phosphoric acid derivatives (to separate metals)

Other reagents

• Ammonia

• Sodium hydroxide

• Hydrogen peroxide

These help dissolve, separate, and purify cobalt and copper.

☣️ 4) Toxic byproducts created during mining

Even if not directly added, mining generates dangerous substances:

Acid mine drainage

• Forms when sulfide minerals react with air + water

• Produces sulfuric acid + dissolved metals

Toxic gases

• Sulfur dioxide

• Hydrogen sulfide

Dust & particulates

• Silica dust (causes lung disease)

• Metal-laden dust (cobalt, uranium, etc.)

Putting 3 and 3 together.

As explained above, one of the elements regularly released in all of the different mining activities both artisanal and industrial is Arsenic. Not only direct poisoning but much worse it waterway and air contamination. Now we should all be very aware having heard of Arsenic as being used as one of the most prevalent poisons for thousands of years:

Arsenic has been used as a poison for thousands of years, and it’s one of the most infamous poisons in history.

🧪 Why arsenic was so widely used

Arsenic became a “classic” poison because:

• Colorless, tasteless, and odorless (in common forms like arsenic trioxide)

• Easy to mix into food or drink

• Causes symptoms (vomiting, diarrhea) that used to look like natural illness

• Widely available historically in medicines, pesticides, and pigments

🏛️ Historical use as poison

Ancient world

• Known in ancient Greece and Rome

• The Roman writer Pliny the Elder described arsenic compounds

• Poisoning was already associated with political intrigue

Renaissance & early modern Europe

• Became notorious among elites and nobility

• Sometimes called “inheritance powder” because it was used to eliminate rivals or family members

• Associated with famous poisoning cases (e.g., the Borgia family—though some stories are exaggerated)

18th–19th centuries

• Arsenic poisoning became extremely common

• Sold openly as rat poison and even used in cosmetics and medicines

• Earned the nickname “the king of poisons”.

So I mean call me a conspiracy theorist and stuff but I just thought I’d have a look at what the symptomology of Arsenic Poisoning was and compare it side by side with that of claimed “Ebola”, largely as outlined at the very start of this article that it just isn’t very plausible that some “viruses” do nothing then all of a sudden some just melt your face off. Just to really ram home the point I made a little infographic about it:

So interestingly enough, Arsenic poisoning happens to share absolutely identical symptomology with claimed “Ebola” (this gets better). I then made an infographic of the latest hotspots and cases of the 2026 “Outbreak” in DR Congo and laid it over a picture of known high Arsenic contamination levels in mining areas and waterway channels connected to them.

Would you know it that they neatly line up in these areas. Further to this it is well documented that many clusters of these come directly from mine workers themselves, as well as many other African countries that have supposedly experienced these “Outbreaks”.

Da “Virus”

We’ve kind of worked backwards in this article, usually we start with the smallest thing first (The non existent entity), work through its lack of contagion then finally onto the plausible substitutes for what is actually causing the blamed disease, if applicable. With Ebola, because of the so very obvious localized Terrain that this occurs in and with a culprit so bang on, I thought I would start with all of that evidence and leave the ridiculousness to the end. Really the Virological part to the “Ebola” hoax is so laughable it hurts, especially for the actual particle they claim it is.

First on the chopping board is claimed contagion. Obviously the “ethics” committee is in full flow on this one, because the gasping and shock horror sounds when you suggest that they provide you any evidence of human transmission that wasn’t don’t with Kary Mullis’ flashing fraud box. “No!” they proclaim “Why everyone would die! if we infected them with Ebola!!”. Again these torture junkies are salivating at the bit to kill lots of animals though aren’t they, so let’s have a look at when they gave what they consider to be purified “Kidney Melter” to a bunch of Rhesus Monkeys:

That’s right, shortly before Euthanizing them (once again the Ethics committee- the HR of the clinical trials world, weigh in on this one to cover up the failure) they logged the symptoms of these monkeys and the only thing they managed to track was a lack of biscuit consumption. I mean call me a skeptic but if you were trapped in a cage, held down and injected with shit and then saw all of your mates being taken away one by one, it might put you off your digestives a bit. But needless to say, not even a snifter of melted kidneys were seen in these symptom sets, as usual they kill the monkeys, dissect them and point at different color of the brutalized body parts they have brutalized with their dissection.

TEM

Mainstream Consensus:

From the Published, Peer Reviewed Journal of Virology images of claimed Ebola Virus in Vero Cells:

Source 2: Claimed Zaire Ebola on Research Gate

Source 3: Claimed Human Cell Expressing Ebola Protein with Ebola Virions visible

Source 4:

Control Culture TEMs:

Interpretation

Demonstrated in the clear images cross referenced that the particles that are being labelled as Ebola Virus are strands of Filopodia, the spacing where they intersect the 2d plain of the TEM slice some cross sectional, some longitudinal showing protrusions is identical in infected and uninfected. The American Society For MicroBiology even uses Vero cells to claim to show Ebola Virions, a cell that is well known to have plenty of Filopodia as shown in our uninfected culture TEM.

A Milky Culture

Thank you to Marvin Haberland and NEXT Level for pointing this ridiculously funny cell culture self own. In this paper it is about “Ebola” which is why I will include it here in this article, however it really isn’t anything specific rather than falsifying the Cell Culture Isolation Technique (Once again- as if it wasn’t already lying in tatters on the floor.

3.5. Breast Milk and Semen Induced Cytotoxicity Using In Vitro and In Vivo Isolation Methods

The matrix effect (cytotoxicity) of normal breast milk and semen was tested in MDM, Vero E6, and Huh-7 cells. Breast milk or semen, whether whole or clarified by centrifugation, were added to 90% confluent monolayers of each of the three cell types. A control flask with only media was incubated in parallel. Cell monolayers were photographed at days 0 (after 1-h incubation), 3, 7, and 10 post-exposure (not all images shown, Figure 5). Breast milk was cytotoxic on Vero E6 and MDM cells at volumes of 50 and 100 µL. However, breast milk visually appears less toxic in Huh-7 cells. Toxicity was initially identified (day 0 post-exposure) in the 100-µL treatment, and the cell monolayer recovered by day 10 post-exposure. Breast milk that was clarified by centrifugation was not toxic at the concentrations tested. Whole semen and semen clarified by centrifugation were both slightly cytotoxic in MDM cells but not Vero E6 or Huh-7 cells (Table 3). Images of cell monolayers at ten days following semen or breast milk exposure are displayed (Figure 5).

Figure 5. 10× images of MDM, Vero E6, and Huh-7 cells taken 10 days following exposure to select volumes of normal semen, breast milk, or cell culture media (control). Breast milk was toxic at 50 and 100 µL/T-25 flask on Vero E6 cells (no cells present after 10 days) and MDM cells, but toxicity was less on these cells than on Huh7 cells.

Additionally, two litters of suckling laboratory mice were injected IC with 10 µL of breast milk, semen, or cell culture media. No laboratory mice experienced fatality during the 10 days after injection (Table 3). Two animals exposed to semen did not recover from anesthesia and were not counted against the number of survivors.

To determine if matrix effect impacts virus isolation success, spiked semen and breast milk were inoculated onto VeroE6, Huh-7, or MDM cells as described above. Results were compared to media only preparations using the log binomial likelihood ratio statistic and compared to the chi-squared reference distribution with significance considered at the 0.05 level. Again, there was no statistical difference in isolation success for spiked media samples across cell types. VeroE6 and Huh-7 cells were both successful at isolating virus at the same dilutions (p = 0.96) and both demonstrated significantly better virus isolation success from spiked semen samples than MDM cells (p < 0.01). Virus was not isolated from any of the spiked breast milk samples even though the cell monolayers appeared healthy. Isolation success from spiked semen or media were not significantly different by across the cell types (Table 4).

Table 4. Virus isolation success from spiked breast milk and semen samples (n = 12).

4. Discussion

Potential semen- or breast milk-associated matrix toxicity was also assessed for these same methods. Huh-7 cells and brains of suckling BALB/c laboratory mice were the most resistant to breast milk-associated matrix toxicity. Interestingly, concentrations of breast milk that were shown to be toxic when unaltered were not toxic following clarification by centrifugation. This suggests the matrix cytotoxicity of breast milk is most likely related to components of the sample that were centrifuged out. Whole semen and semen clarified by centrifugation were both slightly cytotoxic in MDM cells but not Vero E6 or Huh-7 cells, suggesting the cytotoxicity is related to soluble matrix components that were not removed by the centrifugation process. Though the normal semen and breast milk used in this study were from individual healthy donors, it is unknown how much matrix toxicity would vary between donors or health status. Virus isolation was not successful from spiked breast milk and the mechanism of virus replication inhibition is unknown. The isolation attempts were made by two different users on two separate days in parallel with the isolation spiked semen or media control. If virus isolation from breast milk samples will be pursued in the future, altenative isolation methods will need to be identified. Additionally, although components of semen have been reported to increase EBOV infection in HeLa cells, in the present study virus isolation from spiked whole semen was as sensitive as the media matrix samples. The difference in results from these two studies may be explained by the use of whole semen instead of seminal plasma or components of semen as well as a differences in the in vitro effects of these matrices on the cell lines used

ANALYSIS

Why they decided to put breast milk into a cell culture is unclear, but I am very grateful they did as it sets up one of the most comedy falsifications in Virology. They note that in all cases uninfected breast milk put in as a sample to a Cell Culture produces CPE. This is again the same in most cases when they put uninfected semen in too (Don’t ask). Strangely after this they decided to spike in some “ebola” into the milk and cum and try and culture it. Even more strangely despite milk creating the CPE on its own, when combined with “Ebola” it then somehow undid the CPE.

What I believe is happening is that given these two fluids have a very different ionic balance for their very different roles, in the uninfected cultures they are not providing extra nutrients to the assumed reduced FBS (They don’t list a proper method- surprised, not). The cells go into starvation and produce the CPE. When they are coming to the “neutralizing matrix” with spike ins, they readily admit they compare them to the baseline they had (Which IS surprising, as benchmarking is a rarity in soyence). Potentially active semen would reduce the nutrients and cause extra CPE, the breast milk not and the addition of the spike in provided enough serum to keep the CPE observed the same. This invokes the John Enders “the samples both show CPE but look different” thing again.

They even carried out a control infection with the uninfected breast milk and semen and injected it into their newborn mice (Sick psychopaths). They proudly proclaim that the newborn mice survived the 10 day period they gave them to live claiming it was a “successful” control. Except when you read the fine print, 2 of the mice actually died, they just didn’t count them because apparently they died too soon SMH.

CONCLUSION

Whenever there are extreme claims of things happening within the reams of FakeVirusology it pleases me greatly. With the nothing burger ones like Sars Cov 2, Influenza etc the ground data so so easily obscured. With symptoms, even when claimed “symptomatic” they can be ridiculous things like a blocked nose (anosmia), coughing or a headache. Of course these things are just everyday occurrences, you can blame patterns of these things on practically anything and you would find some statistical significance. But here, right at the other end of the spectrum, is Ebola and Hantavirus, get some rat piss in your chicken curry on a cruise or get a dodgy bat burger whilst trekking through the Congolese rainforest and wham you are a goner. There is no leeway, no matter how much they kick and scream with these fake viruses.

It rules out the PCR/ Asymptomatic claim for even being too much of a clownmaxxing posture for the hoax perpetrators to pull off. Extraordinary claims require extraordinary evidence and so this wheelhouse of apocalyptic invisible bugs really does need some solid death stats when they are injecting animals with it. So when they are injecting it with syringes full of the stuff and instead of them pissing blood out their eyes they are measuring biscuit consumption we should be able to call hoax just on that one metric alone.

Really we should be able to call foul on the whole thing from, just the plain old illogical nature of the Germ Theory. If a contagious disease with a 40% death rate that causes you to piss the infected blood everywhere (like the MOVIE 28 days later) then humanity would have been wiped out many millennia ago, indeed there would be no life on earth, presumably apart from Ebola and the Rat Piss virus, just hanging out at a Club Med talking about the good old days when they had a host to infect.

For me personally the actual particle they claim is an “Ebola” virus is so funny. It is like they really went out of their way for the Hollywood props department to not choose the standard blob they find in the cell culture, no it is giving “Snakes on a Plane” vibes with this one, the serpent, the parasite feel to it. When I had a look at these cells under a Transmission electron microscope it was so comedically obvious, the filopodia, the hair like structures that a cell grows when stressed to become motile are being falsely labelled as “Ebola”. The fact that they always point to claimed Ebola right outside the cell exactly where these filopodia are usually located. The whole thing is absurd.

We saw how a long history of slavery by these demonic people forces innocent people to endanger their lives on a daily basis, how these mining activities, ironically for the Green Agenda are polluting the air, water and soil with incredibly toxic poisons and heavy metals that cause these exact extreme symptoms blamed on the non existent pathogen. Arsenic has the absolute identical profile for being the actual murder culprit whenever the extreme symptoms are seen. As with all these hoaxes I would still not want to say “All deaths blamed on Ebola are Arsenic Poisoning”, when it comes to health and hoaxes there are infinite variables at play. Firstly only 16k people have ever claimed died from Ebola in history, which is relatively miniscule especially in countries such as Uganda that have been home to many admitted Genocides.

So when analyzing these things, firstly has it happened at all? With only 16k in history we can be sure that the vast majority of those would not have the exact eye bleeding kidney melting hemorrhagic fever as described, if indeed they have died in anything other than by a Machete wielding Genocidal Maniac Politician and their henchmen. We then can move on and say, OK there are a few thousand dying in this hemorrhagic fashion but it might not all be because of Arsenic, the patterns might not match up. Well there is a raft of other natural earth poisons and heavy metals in these areas; mercury, lead, cyanide etc… it could always be a nice little cocktail. Any which way I hope you can see the very plausible nature of being able to explain violent symptomatic deaths like Hemorrhagic fever much much better with chemical/elemental poisoning.

If you have enjoyed this article and want to support the project with a one time donation please BuyMeACoffee, thanks!

This article is available as a downloadable EBook along with the rest of my work on ShadowBanned Library

Thank you to Dr Lisa Hutchinson for pointing this out to me on a cold and miserable January day, it lifted my spirits.

This is one of those ones that as a common man, of just average intelligence I pride myself on being able to decipher complex issues based on a reliance of common sense and logic. Where more academically minded people are either indoctrinated or intentionally excising this part of their psyche, I always place it front and center as a kind of lock and key mechanism to discernment, call it the “bullshit test” if you will.

The only real 2 talking points of the celebrity “freedom” movement when is comes to PCR are massively tired now through their sheer repetition as well as their superficiality. They challenge nothing about the inherent mechanisms of this “Test” and assume nearly every moving part and reagent is as it should be, rigorously tested and benchmarked, and able to give good results if used correctly. These talking points are; PCR used at too many cycles is inaccurate and the fact that some establishment shill by the name of Kary Mullis once waffled on about some Buddhist notion of being interconnected and that his machine can “find anything in anybody”, which dim people interpret him as saying it can’t be used as a diagnostic (Despite him writing that it could in his patent, in the acceptance of his Nobel Prize and in a letter to the judge of a man accused of spreading “HIV” that Kary got jailed for 8 years).

When you lay everything out on the table this isn’t a very incisive rebuttal of THE machine that fakes pandemics, it’s almost as if most of these talking heads don’t actually want to show that the pandemic was a hoax and to keep the “Virus” lie alive. Of course any machine is inaccurate when you use it in the upper limits of its functionality this is about as crass a rebuttal as can come. Of course nefarious actors will claim they can use this piece of machinery to tell you whatever they want to be able to control you, “You have HIV, coz the machine went blip”… “You owe us $1540 in back payed Tax because the machine went blip”…. “You have been banned from all social media, because the machine went blip” so on and so forth.

So when I hear this piece of information, I literally burst out laughing. It was one of those pieces of information that flew out of the blocks ran straight at the lock and key mechanism on my mental discernment door and crack its head on the door frame, bent over and passed out. I instantly knew that there was no way that this was going to pass the “bullshit test” went put to scrutiny, yet it had been sitting there, quite comfortably bullshitting away under everyone’s nose:

A PCR CYCLE IS PHYSICALLY IMPOSSIBLE.

That is once again, as is becoming a bit of a habit written in a bit of a clickbait stylee. Of course a PCR cycle is physically possible, you just heat up the sample, then cool it down a bit and then heat it back up again. What I mean is that, and it would obviously be too long to put it in a subtitle, given the amount of time it is claimed and the strength and efficiency of the heating modules, it is physically impossible to heat up and cool down these samples in the allotted time they claim AKA A cycle is not a cycle as they claim AKA fraud.

Eppendorf Mastercycler X40 — Full Technical Specifications

General & Physical
Model: Mastercycler X40 (Touchscreen, order no. 6381000077)
Dimensions (W x D x H): 24.5 x 38.5 x 23 cm (9.7 x 15.2 x 9.1 in)
Weight: 7.25 kg (approx. 16 lbs)
Power supply: 100–240 V, 50–60 Hz
Power consumption: 500 W (max)
Noise level: 40.5 dB(A)

Thermal Performance
Block type: Aluminum, 96-well
Heating technology: Three Peltier elements
Temperature range: 4–99 °C
Max heating ramp rate: 3.3 °C/s
Max cooling ramp rate: 1.5 °C/s
Temperature accuracy: ±0.15 °C
Temperature uniformity (20–72 °C): ±0.2 °C
Temperature uniformity (72–95 °C): ±0.3 °C

Gradient Function
Gradient format: 12-column linear gradient
Gradient range: 1–30 °C
Gradient temperature range: 30–99 °C

Heated Lid
Type: SafeLid with sample protection
Temperature range: 37–110 °C

Compatible Consumables
0.1 and 0.2 mL tubes and strips
Full-skirted, semi-skirted, and unskirted 96-well plates

Memory & Interface
Max program storage: 5,000 programs
Display: 7-inch chemical-resistant glass touchscreen
Connectivity: Ethernet, USB (front), VisioNize ready (remote monitoring)

Key Operational Modes
Temperature control modes: Fast, Medium, Standard, Safe
Cycling capacity: 5,000 cycles of standard PCR
ACT certified for environmental impact

A PCR CYCLE RUNTIME

Standard PCR Run Time for 40 Cycles on Eppendorf Mastercycler X40

Total run time typically falls between 60 and 70 minutes for a standard protocol.

Standard Cycle Times (40 cycles)

Protocol per cycle (denature + anneal/extend) / Approx. total time:

• 15 sec denature + 60 sec anneal/extend = ~70 minutes

• 5 sec denature + 30 sec anneal/extend = ~43 minutes

• 5 sec denature + 20 sec anneal/extend = ~37 minutes

Ramping Speed Specifications (hardware limits)

Heating rate: 3.3 °C/second (max)
Cooling rate: 1.5 °C/second (max)

Quick Reference for Common Setups on the X40

Fast/short protocol (e.g., 5s denature, 20s anneal): ~37 minutes
Standard/typical protocol (e.g., 15s denature, 60s anneal): 60–70 minutes
Slow/long protocol (long hold times or Safe mode): ~2 hours or more

How to Decide PCR Cycle Times (Hold Times)

There are three steps: denaturation, annealing, and extension. Each has its own rules.

1. Denaturation (94–98°C)

This separates double-stranded DNA into single strands.

Factors that affect time:

• Template complexity: Genomic DNA (human, plant) needs 1–3 minutes for initial denaturation. Plasmids or simple templates need only 10–30 seconds.

• GC-rich templates: If DNA has high GC content (stronger bonds), increase denaturation time or temperature slightly.

• Cyclic denaturation: In later cycles, 5–15 seconds is usually sufficient because the amplicon is much shorter.

General rule: 10–30 seconds per cycle for standard templates. Longer for complex genomic DNA.

2. Annealing (50–68°C)

Primers bind to complementary sequences on the template.

Factors that affect time:

• Primer length and Tm: Annealing temperature is typically set 3–5°C below the primer’s melting temperature (Tm).

• Primer concentration: Higher primer concentration allows shorter annealing time (e.g., 10–15 seconds).

• GC content: GC-rich primers have higher Tm but do not need longer times.

General rule: 15–30 seconds is typical. Longer annealing times (1–2 minutes) are rarely needed and can increase non-specific binding.

3. Extension (72°C)

DNA polymerase synthesizes the new complementary strand.

Factors that affect time:

• Amplicon length: This is the single biggest factor. Standard Taq polymerase extends at ~1 kb per minute.

• Polymerase speed: Some engineered polymerases are faster (2–4 kb/min). Check the manufacturer’s datasheet.

• Complexity: For amplicons under 1 kb, 15–30 seconds is often sufficient.

General rule: 30–60 seconds per 1 kb of target length.

Quick Reference Table (Extension Times)

Amplicon length / Extension time (standard Taq) / Extension time (fast polymerase)

• Under 500 bp: 15–30 seconds / 5–10 seconds

• 500 bp to 1 kb: 30–60 seconds / 10–15 seconds

• 1 to 2 kb: 60–90 seconds / 15–30 seconds

• 2 to 4 kb: 90–120 seconds / 30–60 seconds

• Over 4 kb: 2–4 minutes / 60–120 seconds

Example: Choosing Times for a Typical Experiment

Scenario: Amplify a 750 bp fragment from human genomic DNA using standard Taq polymerase.

• Initial denaturation: 2 minutes at 95°C (human genomic DNA needs longer)

• Cyclic denaturation: 15 seconds at 95°C

• Annealing: 20 seconds at 60°C (primer Tm is 63°C; use 3°C below)

• Extension: 45 seconds at 72°C (750 bp = 45 seconds at 1 kb/min)

• Final extension: 5 minutes at 72°C (ensures all products are fully extended)

Total run time for 40 cycles on Mastercycler X40: Approximately 60–70 minutes using standard mode.

Key Takeaways

• Amplicon length drives extension time (1 minute per kb)

• Template complexity drives denaturation time

• Primer Tm drives annealing temperature (not really time)

• Polymerase speed can dramatically shorten extension times

Total Run Time Calculation for 40 Cycles on Mastercycler X40

Protocol used:

• Initial denaturation: 2 minutes at 95°C

• Per cycle (40 cycles): 15 seconds at 95°C + 20 seconds at 60°C + 45 seconds at 72°C

• Final extension: 5 minutes at 72°C

Step-by-Step Calculation:

Step 1: Initial denaturation
2 minutes = 120 seconds

Step 2: One cycle (hold times only)
15 + 20 + 45 = 80 seconds per cycle

Step 3: 40 cycles (hold times only)
80 seconds × 40 cycles = 3,200 seconds = 53 minutes 20 seconds

Step 4: Final extension
5 minutes = 300 seconds

Step 5: Total hold time
120 + 3,200 + 300 = 3,620 seconds = 60 minutes 20 seconds

Step 6: Adding ramp times (heating and cooling between temperatures)

Cooling from 95°C to 60°C (35°C drop): at 1.5°C/s = ~23 seconds

Heating from 60°C to 72°C (12°C rise): at 3.3°C/s = ~4 seconds

Total ramp time per cycle = ~27 seconds

Total ramp time for 40 cycles = 27 × 40 = 1,080 seconds = 18 minutes

Final Total Run Time:
Total hold time: 60 minutes 20 seconds
Total ramp time: 18 minutes
GRAND TOTAL: 78 minutes 20 seconds (approximately 1 hour 18 minutes)

ALUMINIUM HEATING BLOCK WEIGHT

Block Weight Estimate for Eppendorf Mastercycler X40

Total instrument weight: 7.25 kg (approx. 16 lbs)

Estimated aluminum block weight (alone): 1.1 – 1.5 kg (approx. 2.4 – 3.3 lbs)

The block accounts for roughly 15–20% of the total instrument weight.

Supporting data from other manufacturers (removable 96-well aluminum blocks):

• Gilson 96-well block: 0.91 kg

• LLG 96-well block: 0.70 kg

• Thermo Scientific 96-well block: 1.40 kg

Why the X40 block is likely heavier (1.1-1.5 kg range):

• The X40 block is not a simple passive block. It is an active thermoblock permanently integrated with three Peltier heating/cooling elements and temperature sensors.

• Removable blocks (0.7-1.4 kg) are passive and have no built-in electronics.

• The integrated design adds complexity and mass, placing the X40 block at the higher end of the weight range.

Comparison with other thermal cyclers:

• Mastercycler X40 total weight: 7.25 kg

• Mastercycler X50 total weight: 10.7 kg

• Typical competitor 96-well cyclers: 11-12 kg total

Important note: The 1.1-1.5 kg figure is for the aluminum block alone. It does NOT include the housing, electronics, Peltier elements, heated lid, or power supply. The remaining ~6 kg covers everything else in the instrument.

Eppendorf does not publish the block weight separately because it is a permanently integrated, non-user-replaceable component.

PELTIER MODULE POWER

Corrected Power Breakdown for Eppendorf Mastercycler X40

Total maximum power consumption (whole unit): 500 W

Estimated power draw by component:

• Three Peltier modules (heating/cooling): 300 – 400 W

• Heated lid (up to 110°C): 50 – 100 W

• Electronics, 7” touchscreen, fans, USB/Ethernet: 50 – 100 W

TOTAL: 500 W

Important notes:

• The Peltier modules are the dominant power consumer, using 60-80% of the total 500 W budget.

• The remaining 100-200 W is shared between the heated lid and the onboard electronics.

• These figures are estimates. Eppendorf does not publish the isolated wattage of individual components. Only the total unit power consumption (500 W) is specified in official documentation.

Reasoning for the corrected range:

• If lid + electronics draw 100 W (low end), Peltier modules draw 400 W.

• If lid + electronics draw 200 W (high end), Peltier modules draw 300 W.

Therefore, Peltier modules = 300 – 400 W.

Short answer: there isn’t a single time — it can range from a few seconds to over a minute depending on what you mean by “on its own.” But here’s the physically correct way to think about it:

Key point (important)

A Peltier module does not “heat itself up” efficiently in isolation — it moves heat from one side to the other.

So:

• One side gets hot

• The other side gets cold

• The temperature rise depends on load, heat sinking, and thermal mass

If you literally mean “bare module in air” (no load, no heatsink)

• Very low thermal mass (~20–40 g ceramic + semiconductors)

• Electrical input: ~100 W

Rough estimate:

• Heat capacity ≈ ~20–40 J/°C

• Energy for +35 °C ≈ ~700–1400 J

At 100 W:

• ~7–15 seconds (ideal)

• Realistically: ~10–30 seconds

BUT:

• It will quickly become unstable

• The hot side will overheat while the cold side drops

• Risk of damage without heat dissipation

If you mean “with proper heatsink (normal operation)”

Then:

• The module doesn’t just heat up — it establishes a temperature gradient (ΔT)

Typical behavior:

• ΔT builds over 10–60 seconds

• Maximum ΔT (~50–70 °C) may take 30–120 seconds

So for a 35 °C difference:

• ~10–40 seconds is typical

Why it’s not a simple answer

Because time depends heavily on:

• thermal load

• heatsinking efficiency

• airflow

• drive current

• whether you’re measuring:

  • the hot side

  • the cold side

  • or the difference between them

Bottom line

Bare module: ~10–30 seconds (but unstable / not realistic)

Properly mounted: ~10–40 seconds to establish ~35 °C difference

Q :how long would it take a 100w peltier module just on its own to raise 12 degrees Celsius. short answer

Short answer: about 3 (ideal), more realistically ~5–10 seconds.

That assumes:

• no heatsink / minimal load

• you’re just heating the module’s own small thermal mass

In real use with any load or heat dissipation, it would take longer.

HEATING AND COOLING TIMES

How long would it take a 400W Peltier module to heat a 1.1 kg block of aluminum by 35 degrees Celsius?

Heating mode ideal calculation:

Mass of aluminum = 1.1 kg
Specific heat capacity of aluminum = 900 J/(kg·°C)
Temperature increase = 35°C

Heat required = mass × specific heat × temperature rise
Heat required = 1.1 × 900 × 35 = 34,650 Joules

Peltier power = 400 W
Time = heat / power = 34,650 / 400 = 86.6 seconds

So ideal heating time = about 87 seconds or 1 minute 27 seconds.

Would it take longer to cool it down?

Yes, because cooling with a Peltier is less efficient than heating.
In heating mode, nearly all electrical power becomes heat.
In cooling mode, the Peltier must pump heat from the cold side to the hot side, and its efficiency is given by the coefficient of performance (COP).

For a temperature difference of 35°C, a realistic COP for a common Peltier module is around 0.4 to 0.5.

Cooling calculation with COP = 0.5:
Effective cooling power = COP × electrical power = 0.5 × 400 = 200 W
Time = heat required / effective cooling power = 34,650 / 200 = 173.3 seconds (2 minutes 53 seconds)

Cooling calculation with COP = 0.4:
Effective cooling power = 0.4 × 400 = 160 W
Time = 34,650 / 160 = 216.6 seconds (3 minutes 37 seconds)

If we also include imperfect thermal contact (say 80% of cooling power reaches the block):
Effective power = 0.8 × 160 = 128 W
Time = 34,650 / 128 = 270.7 seconds (4 minutes 31 seconds)

So realistic cooling time with standard losses ranges from about 3.5 to 4.5 minutes.

Summary:
Heating (ideal, no losses): 87 seconds
Cooling (COP=0.5): 173 seconds
Cooling (COP=0.4): 217 seconds
Cooling (COP=0.4 + 80% transfer): 271 seconds

Final practical cooling time: 3.5 to 4.5 minutes.

Taking exactly the same mass of block but making it a strange shape to accommodate holding Eppendorf tubes.

Short answer: No significant difference in heating time, assuming the Peltier couples well to the shape and heat distributes evenly. Same mass, same material, same temperature rise → same energy required → same time. If the shape reduces thermal contact with the Peltier or increases heat loss to air, it could be slightly slower, but mass for mass, it’s essentially the same.

Halfway Analysis

I don’t want you to get too fatigued with the AI splurg so I think we should discuss the bombshell stuff that has already dropped before we really turn the screw and ram it home just how ridiculous this is.

Let’s break this down to give you a perspective on what a shitshow this is. The PCR thermocyclers of yore used water and oil baths with resistive heaters the likes of which you might find in a kettle. Sounds old and clunky right. Fine. Now, in practically every machine right the way to the flagship Quant 7 thermocyclers ($70k+) they use Peltier modules which you can get on Aliexpress for £2.99. These will be practically very similar to any heating module in these thermocyclers.

The way these pieces of shit work is not a simple heating up of a resistor, but it is inducing of a current in a layer of semiconductors that excites one side causing it to heat up and the resultant heat draw causes the opposite side to cool down. Reverse the polarity and the sides swap cold for hot. Sound a bit tenuous and not particularly quick? Correct. These modules are not used for their speed but rather because they can both heat and cool, are cheap and to be fair to them pretty accurate (when they eventually get to the right temperature).They do this with a big heat aluminum heat sink, which in our case is the 1.1kg behemoth that holds the Eppendorf tubes with the samples in them. Attached to the heat sink are fans to try and cool the sink when the polarity is reversed as quite coincidentally the largest temp difference in the cycle is the cooling cycle which is the least efficient phase for a Peltier module to carry out.

Now we can see roughly the pony electronics that are going on inside over these astronomically overpriced pieces of shit, let us take a look at some of the basic numbers going on. The manufacturers state in their own literature that the ramp up and ramp down times, i.e the time it takes to get to the denaturation, annealing and extension phases of the cycle , are an astounding 1.5C/s cooling and 3.3C/s heating. Giving us a total wait time between phases of just 27 seconds.

Cooling from 95°C to 60°C (35°C drop): at 1.5°C/s = ~23 seconds

Heating from 60°C to 72°C (12°C rise): at 3.3°C/s = ~4 seconds

Total ramp time per cycle = ~27 seconds

Total ramp time for 40 cycles = 27 × 40 = 1,080 seconds = 18 minutes

Let’s zoom in on just one section of this, to keep it clean and understandable. The manufacturer’s documents claim that to ramp up from Annealing phase to Extension phase they can heat the 1.1kg Aluminum block, the 96 plastic Eppendorf tubes AND their liquid contents up by 12 degrees in just 4 seconds. If you don’t think that sounds absurd you very shortly will.

Q :how long would it take a 100w peltier module just on its own to raise 12 degrees Celsius. short answer

Short answer: about 3 (ideal), more realistically ~5–10 seconds.

Again the manufacturer states there are 3 Peltier modules in the x40 thermocycler. With a total wattage of the unit at 500w, we can assume that the power consumption of the heating modules is between say 300-400w. Let’s keep it clean and say that each module is 100w. As above, AI gives the conservative estimate that a 100w Peltier module would take at the very least, in a real world setting 5 seconds to HEAT ITSELF UP. I.e for the module itself to get that hot, not heating anything at all. It puts its upper limits at twice that which it claims brings the sample up to temperature.

So I did the calculation for the longest part of these ramping cycles being the cool down phase from denaturation to annealing. A large cooling drop of 35 degrees Celsius that the manufacturers claim can be done in just 23 seconds. To validate the first step of this I got two different AIs to run with how long it would heat the manufacturer specified 1.1kg Aluminum block that holds the Eppendorf Tubes. We are completely disregarding anything else for the moment. Just the Peltier modules and the block, which when calculated how long even the absolute maximum wattage draw possible of 400W takes an estimated:

Final practical cooling time: 3.5 to 4.5 minutes.

This is ignoring the fact that the shape of the Aluminium Block given that it is cast to hold the Eppendorf tubes is not the most efficient shape to heat up, it still gives out a time that is between 9 and 13 times longer than the manufacturers claim it takes to bring the sample up to temp.

No Sense

Q: In a x40 eppendorf thermocycler do they have temperature sensors that take measurements of the samples?

No. The Mastercycler X40 controls the temperature of the aluminum block, not the samples directly, using multiple Peltier elements.

So here we see, if we take every ridiculous notion away from this theory of a heating cycle as they describe it. There is no actual temperature reading in the thing they are testing, the sample. How is it then they can claim consistency?

Q: Is the temperature adjusted depending on the size of the sample?

No. The temperature profile is set by the user based on the block, not adjusted automatically by sample volume. The user must manually optimize cycling conditions (e.g., extension times) for different sample volumes.

Again we see a fundamental problem with this idea of heating temperatures is that at no point are any of the metrics changed for the amount of sample in an Eppendorf tube. This would surely be a massive limiting factor when the amount of seconds at each phase of the cycle are said to be crucial especially to things like melt curves.

Temperature Sensor Positioning

Q: So the temperature sensor is mounted to the bottom of the aluminum block straight above the Peltier modules?

Yes, that is exactly correct.

The temperature sensors are mounted on the bottom surface of the aluminum block, positioned directly above the three Peltier modules

As you can see from the diagrams above, the temperature sensor is mounted to the underside of the Aluminum block, this is an absolutely crucial piece of information as it seems to me as why we get a huge difference in measured to calculated temperatures: The sensors are basically reading off the temperature of the Peltier modules, nothing to do with the block being heated at all.

It gets Worse

RAMP DOWN Denaturation to Annealing 90-65 Degrees C.

Thank you for sharing ChatGPT’s detailed breakdown. That analysis is excellent and highlights a key point I missed earlier: my estimate assumed the Peltier’s cold side was directly cooling the block, but I did not fully account for how drastically the module’s cooling power collapses as the temperature difference (ΔT) across it increases. ChatGPT correctly notes that a “400W” Peltier might only deliver 50–120W of actual cooling when pulling a 25°C differential (from 65°C cold side to ~90°C hot side). My earlier COP assumption of 0.3–0.6 (120–240W) was therefore too optimistic for a real-world air-cooled setup.

Given that, I agree with ChatGPT’s revised framework. For your 1.1 kg aluminum block cooling from 90°C to 65°C (24,750 J to remove), with a realistic cooling power of 50–120W, the ideal time before losses is 3.4 to 8.3 minutes. Adding real-world penalties (heat leaks, interface resistance, hot-side sink limitations) extends this further. Therefore, the best estimate for your setup—assuming a decent heatsink with fan, but not liquid cooling—is 6 to 10 minutes for the block alone. Adding the 5–10 seconds for the 50 µL Eppendorf tube liquid to equilibrate is negligible; call it 6 to 10 minutes total. This is substantially longer than my previous 2–3.5 minute estimate, and I acknowledge ChatGPT’s figure as more realistic for a typical benchtop Peltier cooler without aggressive hot-side management.

RAMP UP Annealing 65-77 Degrees C

Assuming the liquid is water-based, 50 µL (50 mg) requires only about 2.5 Joules to heat from 60°C to 72°C, and the plastic Eppendorf tube adds a small additional thermal mass. This is negligible compared to the ~11,950 Joules needed for the 1.1 kg aluminum block. The rate-limiting step is heating the block, not the tiny sample. Once the block reaches temperature, the liquid and tube will need a few extra seconds to equilibrate.

Therefore, the total estimated time is 65 to 100 seconds. This breaks down as 60–90 seconds to heat the aluminum block from 60°C to 72°C (based on the Peltier’s real-world efficiency of ~200–250W effective heating power), plus an additional 5–10 seconds for the 50 µL liquid inside the Eppendorf tube to thermally equilibrate with the block. In a well-coupled setup (tube snugly inserted with thermal paste or direct contact), you should expect the entire assembly to reach 72°C within roughly 75–100 seconds.

Total Time

Low Estimate 7 mins 15 seconds of ramp intervals.

High Estimate 11 mins 40 seconds of ramp intervals.

Normal Cycle Run Time: 60 mins 12 seconds.

CALCULATED TOTAL RUN TIME

This is the calculated total runtime according to multiple different AI programmers of how long a PCR reaction would take in a thermocycler, if the claimed samples temperatures were reached given all the manufacturer specifications.

Low Estimate: 6 hrs and 2 minutes.

High Estimate: 8 hrs 46 minutes and 52 seconds

Double the Power

Right to really stress test this I have run a few of the calculations but doubling the power of the Peltier modules to 800w, this is 300w more than the entire thermocycler pulls:

Your earlier estimate is on the right track, but the scaling from 400 W → 800 W is not linear for Peltiers—this is the key thing to correct before giving a final answer.

An “800 W” Peltier doesn’t give you 2× the cooling of a 400 W unit. In reality you usually get ~1.3×–1.6× improvement at best, because:

• Cooling capacity drops fast with ΔT (~25°C here)

• Higher power → more heat dumped on the hot side → harder to remove

• Efficiency (COP) gets worse at higher input power

🔧 Updated realistic cooling ranges

We’ll keep your heat load:

• 24,750 J to remove

Now apply realistic effective cooling power for each class:

🔹 400 W Peltier (baseline)

• Effective cooling @ ΔT ≈ 25°C: 50–120 W

• Real-world result (as you had):

👉 6–10 minutes typical

🔹 600 W Peltier

• Effective cooling: 80–160 W

• Gains limited by heat rejection

👉 Estimated time: 5–8 minutes

🔹 800 W Peltier

• Effective cooling: 100–200 W (only if very well cooled)

• Requires serious heatsink or water cooling to reach upper range

👉 Estimated time: 4–7 minutes

⚠️ Reality check (important)

The upper-end performance (4–5 min) only happens if:

• Large heatsink + high airflow or water cooling

• Excellent thermal contact (clamped + paste)

• Ambient not too warm

If not:

• 800 W behaves much closer to 600 W or even 400 W

• You’ll still see ~6–10 minutes

🧠 Key takeaway

• 400 W → 6–10 min

• 600 W → 5–8 min

• 800 W → 4–7 min

👉 Notice: doubling power only saves ~30–40% time, not 50%

It notes that you by no means get double the heating efficiency by doubling the power, you are more likely to get 1.3x -1.6x benefit. This reduces one stage of the phase ramping from estimates of 6-10minutes to 4-7minutes.

This puts the lowest possible estimate at: 4 Hrs 20 minutes.

WHY!!? and CONCLUSION

I have run these calculations so many times now, with three different AIs (Which give me quite different results, but all drastically over claimed specs), using the manufacturers specs for all the maths and have come up with figures that are consistently 10x above what they claim is occurring in a PCR test. Of course this would change given the thermocycler, there are more powerful, newer ones on the market than the Eppendorf x 40. But again I ran the calculations by doubling the power input that exceeds nearly every thermocyclers Wattage draw on the market, especially the 96 well plate models (As the larger thermocyclers would obviously have larger Aluminum blocks to match).

Maybe I am missing something glaringly obvious but I just can’t see it. It makes sense if you look where they are taking temperature readings from that the timings of literally just the Peltier modules heating or cooling themselves up or down are much closer to the projected times that they state (Surprisingly still longer than they quote). But still this seems absurd to just give this as a temperature reading for a sample that would take 10x longer to reach that temp. Maybe there are other thermocycler models that have temperature sensors on top of the block, closer to the Eppendorf tubes? But surely these would give more accurate readings that show these temperature fluctuations are not being achieved?

Given that this all checks out my biggest question is WHY!? Talking to my wife about this who was trained as an engineer, we both just looked at each other, very much puzzled. I am acutely aware that bugger all benchmarking or validation has been bought into the realms of Virology or Genetics. But I don’t think this applies at all to the world of engineering/tech/electronics. Things are stress tested to within an inch of their lives especially in very expensive pieces of equipment made by multinational corporations, largely because its pretty easy to tell if your marketing about said product is off, of which they would be legally culpable.

At the very very least, even if someone comes along from the recesses on the internet and shows me that I have completely fudged up the calculations. They still do not have a temperature probe IN the sample… that is incredibly sloppy. They still don’t actively adjust heating strength to cater for volume sample size….. that is incredibly sloppy. So given these things and the amount of mental fraud I have uncovered in the realms of Virology and Genetics it could certainly be feasible. It just still doesn’t answer the question of WHY!?

Why do they need to give off the appearance that some very precise temperature is needed for this to work when in actual fact this temp is probably just skimming around the 80 degree mark for the entire length in the actual sample (As calculations show that 7 minutes initial ramp up time to 90 degrees is adequate) ? For what reason has this massive blunder been overlooked? Is it just pure laziness? These companies are making 1000x mark ups on the components and raw materials for these machines. Is it just purely a money making exercise? That would make sense. But the other thing that both me and my wife couldn’t figure out is; surely someone else had noticed? Surely someone on the engineering side working for these companies had put 2 and 2 together non? Surely a User with a basic interest in engineering or indeed logic might have had their suspicions aroused? I’d genuinely like people’s feedback on this and maybe we can all formulate a hypothesis together.

Cheers

J

If you have enjoyed this article and want to support the project with a one time donation please BuyMeACoffee, thanks!

This article is available as a downloadable EBook along with the rest of my work on ShadowBanned Library

I sell no bullshit supplements, no crappy merchandise, no whacko gadgets, I have no sponsors, no advertising and everything is possible to read for free. However to help in running the experiments and to cover the huge costs that are mounting from travel and expenses to operate the project, please consider donating to the largest Crowdsourced and Opensourced experiments falsifying Virology. Thank you.

If you have enjoyed this video and want to support the project with a one time donation please BuyMeACoffee, thanks!

I am doing what I am doing with the Virology Control Studies Project for one reason: So that my children and my children’s children never have to go through 2020 again, be ostracized from society, banned from access to all social and leisure facilities because of a decision to make entry to society predicated on injecting a toxic substance into their and my veins. So when it comes to this topic, I would think and hope, like most parents, I hold my children’s health in the highest of priorities. For even the social credit and freedom to walk around this planet unrestricted still actually plays second fiddle to being healthy whilst doing it. So the decision to not get myself or children stabbed with a syringe full of shit was an easy one, but one that should never have come with conditions of relinquishing that liberty.

As part of this project I have given my reasons for my worldview on No Virus, No DNA and No Contagion of Biological Pathogens and backed them up with not only volumes of theoretical evidence but in the case of Viral Existence with rigorous experimental evidence. These areas of research have a Bi-directional benefit in that hopefully they operate simultaneously to protect you against not only tyrannical political machinations by providing solid rebuttal to political health claims such as Lockdowns and Mask Mandates, but maybe more importantly to protect you against the toxic Drugs and Medical Interventions predicated on the first.

If you truly understand the full, 360 picture of what No Virus, No DNA , No Contagion of Biological Pathogens means, the ramifications of these things rules out a large chunk of the allopathic medicine model and medical interventions. All of the Vaccines, Drugs and medical procedures become surplus to requirements when dealing with non existent causes and erroneous causes in the case of Bacteria, Parasites and Genetics. The last of those, once again, if you truly understand the Genetics hoax, casts aside many many avenues of poison drugs and death and disease causing pathways to prevent and combat an invented cause for ill health.

I am well aware that this may be a bit too much of a broad brushstroke to deal with; for the topic of health is really quite large and also, I would very much hope that you are skeptical of any intersection between the fraudulent worlds of Science and Medicine. I guess this is really the crux of the matter in that I shouldn’t really expect you to transfer any thinking between these wildly independent and separate institutionally fraudulent subjects. If I demonstrate one to be wholesale bollocks as I have started to do with Science, then that may not necessarily mean that the Medicine and Health part are too. I know they are, but that doesn’t really help you now does it?

For I have always been frustrated with the lack of logic, particularly surrounding alternative drugs and supplements, whereby in my mind, if there is a fault in the logic in scientific terms at any of these causal intersections, then that must rule out its medical usage. Once again, to me that is the case, but then I have not put into the public sphere everything that is in my head (I have a backlog of articles waiting to be written for the rest of 2026 FML), hence it is not strictly a given that you should also rule these things out.

So I am going to add to the roster of my writing the specifics on any of these areas of health/medicine/supplements/alternative cures and what I believe to be helpful. I am not going in off the deep end and full blown health guru by any stretch of the imagination, for the simple reason that I recommend basically doing nothing: Your body is brilliant, help it to heal itself, there that’s it, my health guru course in a nutshell…. Pay me. lol. But what I am going to do is flesh out the full take down of these things, much alike I did in my article “Chemotherapy is Mustard Gas”.

Ironically as well, I am not, in this article going to be too specific about a drug or new protocol or intervention, this is very much a general viewpoint as you will quickly come to tell, but it is a viewpoint that changed my life forever and one that made me view lots and lots of things simultaneously through a polar opposite lens. Hence I believe this to be the single most important piece of information on the topic of health:

CLICKBAIT

I was going to write this at the top as some sort of disclaimer, because I realize that the title is fucking inflammatory, if you have read this far and not blurted out in the comments yet about how offended you are that I would even dare to ask such a question then I have probably explained myself well already. But just to clarify, that is not a question I’d ever ask, as I know the answer, of course.

About 70% of the reason for the title is purely because actually writing the title from from the perspective of this article would have been extremely long and tedious. The remaining 30% is, I admit, for the shock factor, as I think to express the sheer gravity of the implications of the topic of this article one has to have the face-melting reaction of intersecting horror, confusion and disgust that comes with it:

UNTIL 1986 (1999 for Premature babies) THE ENTIRE WESTERN MEDICAL ESTABLISHMENT THOUGHT THAT BABIES UNDER THE AGE OF 1YRS OLD COULD NOT FEEL PAIN AND THEIR CRIES WERE INVOLUNTARY NERVOUS SYSTEM RESPONSES.

I am going to stop there and let that piece of information sink in for a while before the next stage:

AND THEY USED TO PERFORM SOME SURGERIES, SUCH AS OPEN HEART SURGERY WITHOUT ANAESTHESIA .

I apologize profusely for the upsetting image, it is one that has stayed with me ever since I first saw it on Twitter, but this is the reality of the Medical Establishment and if you want a true and honest and well researched opinion on how they go about their business then we have to be able to see their “work” for what it is, in its complete and grotesque form. Only when we learn these hard truths can we change ,first as individuals and then hopefully as a society.

Now, as mentioned, I very first saw this as a meme on Twitter, and even the most casual surfer of the Social Media sewer should know that, when you see stuff like this, it is usually, total and utter clickbait bullshit. Especially given that the claim is absolutely wild and it is combined with an offensively sad image. Usually these things contain very small nuggets of truth that are blown completely out of proportion, so much so that they really devalue the notion. I should by all tokens have disregarded it as complete rubbish but the person that shared it, happened to be a friend of mine. So I checked and…… unfortunately it was true:

1.1. Historical Perspective

Routine assessment and management of neonatal pain has evolved to become an important therapeutic goal in the 21^st century. During the 20^th century, however, most procedures and clinical practices established in neonatal intensive care units (NICUs) uniformly denied or disregarded the occurrence of neonatal pain. One unfortunate consequence was that infant surgery was conducted routinely with minimal or no anesthesia until the late 1980s^1,2. Robust responses to painful stimuli were often dismissed as physiological or behavioral reflexes, and not related to the conscious experience of pain³. A recent historical analysis suggests four related causes contributed to a widely prevalent denial of infant pain⁴: 1) a Darwinian view that held newborns as less evolved human beings, 2) extreme caution and skepticism in interpreting scientific data that suggested infant pain, 3) an extreme reductionism whereby a mechanistic “behaviorism” became the dominant model human psychology in the earlier half 20th century (following J. B. Watson’s Behaviorist Manifesto in 1913 ⁵), and as the behaviorist movement waned, it was followed by 4) an era placing undue emphasis on the structural development of the brain and its responses^6-8.

This popular precept was challenged by accumulating data on hormonal-metabolic responses to surgical procedures performed under minimal anesthesia^9,10, which were effectively reduced by giving potent anesthesia^11-13, the identification of a “pain system” and initial data on its early development, rich observations on crying activity and other behaviors of newborns subjected to painful stimuli in the NICU – all of which contributed to a scientific rationale for neonatal pain perception and its clinical implications³. Once the existence of neonatal pain was acknowledged and methods for clinical assessment had been validated^14,15, the stage was set for advances in neonatal pain management.

1.2. Importance of Neonatal Pain

The American Academy of Pediatrics and the Canadian Pediatric Society (AAP/CPS) updated their guidelines in 2006¹⁶, recommending that each health care facility treating newborns should establish a neonatal pain control program that includes:

• Performing routine assessments to detect neonatal pain

• Reducing the number of painful procedures

• Preventing or treating acute pain from bedside invasive procedures

• Anticipating and treating postoperative pain after surgical procedures

• Avoiding prolonged or repetitive pain/stress during NICU care

Numerous clinical studies have demonstrated that failure to treat pain leads to short-term complications and long-term physiological, behavioral, cognitive sequelae including altered pain processing, attention deficit disorder, impaired visual-perceptual ability or visual-motor integration^17-19, and poor executive functions^20,21. Conversely, other studies showed needless analgesic therapy prolongs need for mechanical ventilation, delays feeding, or leads to other sequelae including impaired brain growth, poor socialization skills, and impaired performance in short-term memory tasks^17,18. About 460,000 neonates in the US require care in Neonatal ICUs (NICUs) each year and are exposed to acute pain from invasive procedures or prolonged pain from surgery or inflammation^22-24. Assessing neonatal pain is difficult to teach, time- and labor-intensive, often open to subjective interpretation, and a source of conflict in NICU care.

Until 10 years ago, pain and discomfort in the newborn were not seen as a priority. Babies were operated on with little or no anaesthesia and no analgesia. Babies receiving intensive care were rarely sedated. Attitudes and practices changed quickly following the publication of two key articles, so that pain and its relief are now seen to be important. The major factors in this change were the realization that the newborn feels pain, and demonstration that anaesthesia and analgesia appear to be safe. Ethical issues are raised by the fact that clinicians ignored the existence of pain in the newborn for so long.

Introduction

Over the past 20 years, advances in patient monitoring and anesthetic techniques coupled with a better understanding of the pathophysiology underlying neonatal disease states have made a great impact on the practice of neonatal anesthesia. Nevertheless, whether anesthesia is necessary in neonates and what constitutes adequate anesthesia for neonates are still major concerns among parents, health care professionals, and the public. For the anesthesiologist, the issue of adequate anesthesia is paramount to providing quality medical care. Yet Lippmann et al. (1976) wrote that in surgery for patent ductus arteriosus (PDA), ‘anesthetic or analgesic agents in our experience are unnecessary,’ and in a recent article Gauntlett (1987) stated that only 85 percent of anesthetists responding to a survey believed that newborns perceived pain.

For some anesthesiologists the rationale of withholding anesthesia is still based on the notion that infants requiring surgery are too ill to withstand the significant cardiovascular and respiratory depressant effects of anesthesia. For others, the knowledge that neonatal cortical connections and nerve myelination are incomplete, coupled with the neonate’s primitive reflex (decorticate posturing) in response to pain, allow them to rationalize that operative procedures in neonates can be performed without the benefit of anesthesia.

The issue of pain management, however, is not limited to the operating room. In a survey of intensive care nurses, 59 percent of the responders believed that newborns did not perceive pain in a manner similar to adults, but 77 percent believed that pain medications were underutilized (Franke et al., 1986). Thus, it appears that pain management for newborns is frequently not undertaken or is inadequately administered.

Abstract

Within the past few years, the assumption that preterm infants experience little or no pain has been challenged in nursing and medical literature. It is not clear to what extent changes have taken place in the practice area. The purpose of this qualitative study was to explore the beliefs of NICU nurses and physicians about the existence and treatment of pain in preterm infants. Respondents to the open-ended interviews were 5 neonatologists and i0 nurses at two regional referral neonatal intensive care units in North Carolina. Interviews took from 20 to 40 minutes and were analyzed using the Ethnograph program AU respondents agreed that preterm. infants experience pain. Both groups identified behavioral and physiological cues to pain recognition. There were differences in initial approaches to treatment. However, both groups indicated that the nurse has the pivotal role in recognition and initiation of treatment to reduce or eliminate pain.

CHAT GPT

🧠 What the evidence actually shows (critical clarification)

✔️ What is true

• Many medical practices under-treated or ignored infant pain well into the 1980s.

• Some clinicians believed infant responses were reflexes rather than conscious pain.

• Major change occurred late 1980s → early 1990s, driven by:

  • hormonal stress studies (e.g., Anand et al., late 1980s—often cited though not retrieved above),

  • improved monitoring,

  • safer anesthesia techniques.

❌ What is oversimplified or misleading

• It is not accurate that all or even most doctors universally believed babies “couldn’t feel pain” until a specific year like 1985 or 1999.

• The reality was:

  • debate + uncertainty + risk concerns about anesthesia

  • gradual shift, not a single discovery date

  • earlier awareness existed but wasn’t consistently translated into practice

🧩 Why the misconception persisted

From the literature:

• Difficulty measuring pain in non-verbal patients

• Fear that anesthesia was too dangerous for neonates

• Belief pain might be short-lived or not consciously processed

• Lack of tools and protocols

📌 Bottom line

• The 1980s–early 1990s were indeed the turning point where:

  • strong evidence accumulated

  • clinical guidelines began to change

• But the idea of a single “cutoff year” (1985 or 1999) is not supported by the peer-reviewed literature.

• Instead, it was a gradual scientific and clinical shift.

“FIRST DO NO HARM”

At every opportunity you will invariably hear platformed Doctors and Medics spew forth this virtue signaling bilge phrase as a seemingly moral “get out of jail” free card. It broadcasts to the world around them, or anyone within earshot, that they have indeed your best interest at heart, that they haven’t got a Massive God complex, an earth shattering student loan to repay and an unquestioning belief in a medical textbook and authoritarian hierarchical structure that would make Maoist China look like Woodstock (It’s hard to find an actually truly free analogy).

For, I would say every last one of these institutionalized barbarians has been, it turns out, 100% fueled by its dogmatic religious cult like status and in unison an echo chamber of Dunning Kruger. That is my only explanation for this information above, as it cannot be passed off as a Black Swan when so uniformly presented in the faux inquisitive manner across ALL of the published literature on this subject. So let’s go through a few of the real home truths that should be ringing in your ears after reading this:

Working from the back, Chat GPT is, as one would expect, running cover for these monumentally retarded “thought leaders” of their times. It states that “not all or even most doctors believed that babies couldn’t feel pain until 1999”. This is a double edged sword for the digital version of Lord Haw Haw as really the privately held beliefs of the doctors in this cult make zero difference to how they are expected to behave in the cult. When systems and protocols are written and a chain of command is in place, you are expected to carry out the regimen written based on the beliefs of the person or people who wrote the rules ( bit of a problem, huh Statists?).

If those people, as we can see here by all of the institutional papers being put out through the 80s, 90s and into the new millennium are uniformly only at the stage of posing puzzled questions as to whether babies can feel pain or not (fucking mental) then the institution as a whole has NOT yet adopted a change. You can see this change happen from institutionally believing in BABIES FEELING PAIN (FFFFFS) in the US and Canada at least in 2006 (yes this century, yes just 20 yrs ago) when The American Academy of Pediatrics and the Canadian Pediatric Society (AAP/CPS) updated their guidelines in 2006 recommending that each health care facility treating newborns should establish a neonatal pain control program that included performing routine assessments to detect neonatal pain. Hence we can assume that institutionally beforehand they did NOT routinely detect neonatal pain because they didn’t give a shit about neonatal pain.

Really we don’t even have to be as indirect as this as in the paper “Pain in the Neonate” published in 1993, in a survey the majority (59%) of Intensive care nurses thought that babies didn’t feel pain like adults. Even in anesthetists whose sole job it is to knock people unconscious so they don’t feel pain and thrash about, 15% of them in 1987 explicitly said they believed that babies could not feel pain. This is really squared off in the first paper “Pain Management in Newborns” outlining institutional attitudes when it says “During the 20^th century, however, most procedures and clinical practices established in neonatal intensive care units (NICUs) uniformly denied or disregarded the occurrence of neonatal pain”. There is no real beating about the bush as the sources lead down a reinforcing wormhole back into the 1970s the threshold where there are just no questions about neonatal pain and the protocols and hence establishment just uniformly denied it.

A CASE STUDY

It may be a little boring, so sorry for that, but I have copied this entire article in the rather tellingly named journal “Pediatric & Neonatal Pain” written by Celeste Johnston. I have included the entire article because it gives a complete picture of the thought process going on in the heads of these indoctrinated psychopathic monsters:

Abstract

From 1980 into present day, 2020, the evolution of neonatal pain research is told as a journey by one researcher, Celeste Johnston. At the beginning of her work, there was essentially no interest or work in the area. She was fortunate to be led into the area by a clinical problem: how to determine the amount of pain babies in the NICU were experiencing. That question resulted in over three decades of work with neonates. Measuring pain was the first challenge and is one that remains a focus of current research. Initially, the only choices for treating pain in neonates were either opioids or anesthetics, each with problems. Research on sweet taste and more recently on skin‐to‐skin contact has offered effective and safe options for procedural pain. Although progress has been made in the incidence of pain management in infants, it still is far less than it could be. Steps along the way of measurement, treatment, and knowledge utilization are chronicled by this researcher.

Keywords: animal models of pain, measurement of pain, neonates, non-pharmacological management of pain, pain

1. BACKGROUND

The time this story starts is early in the 1980s. When looking back, it now seems astonishing that in that era almost no attention was given to pain in neonates. There were no measures, no interventions other than opiates, which were rarely used, no policies on neonatal pain management, and prevailing myths that infants either did not feel pain or that it was short lived. I had begun working at the Montreal Children’s Hospital when finishing my doctorate in counseling psychology in 1979. For my dissertation, I studied the effect of peer models as teachers. When I first went to the Children’s, I started work on using peer models for preoperative anxiety in children aged four and older. It became clear early on, that if the pain was controlled, the anxiety was less. This is so obvious in hindsight! I had worked in an adult burn unit after my Masters degree in nursing where, being appalled at the pain burn patients suffered, I started attending pain rounds in the early days of Ron Melzack’s clinical work. I considered that I therefore knew something about pain! I started connecting with different disciplines at the Children’s in an attempt to have better management of pain in young patients, but my early focus was on verbal children.

At some point, in the mid 1980s, I was approached by nurses in the NICU to help with a problem they had regarding palliative care babies. Judi Collinge was the former Head Nurse and remained on the unit as a Research Nurse, and she and I had worked together to form a nursing research group at the Children’s ¹ so she was my conduit into the NICU, bearing in mind that I had no clinical expertise in that population. The nurses’ dilemma was that they perceived babies in palliative care were in pain and nothing was being done for it. They wanted to know how they could prove to the medical staff that the babies were suffering. Could I help them?

2. MEASURING PAIN IN NONVERBAL PATIENTS

In searching the literature for measurements of pain in infants, there was nothing published. It was a tabula rasa. In discussions with colleagues, I did discover that in studies of facial expression or cries, pain had been one condition that had been examined. As I was working on a grant submission, unbeknownst to me, Owens and Todt were conducting research on a description of newborn pain response. Their paper was published in Pain in 1984, ² and my grant was funded in 1985. The Owen and Todt study examined duration of crying and heart rate as parameters, but they had recommended more parameters be used. Happily my application had included 4 parameters including heart rate, crying duration as well as spectrograph analysis, facial expression, and body movement. We published that as a preliminary study. ³

A “pain cry signature” was what I was hoping to find in the next study, along with examining developmental changes over the first year of life. My sample consisted of healthy infants 2, 4, 6, and 12 months of age coming for routine immunization. There were three conditions in which we measured their response, anger with held head so they could not turn surprise with jack‐in‐the‐box, and pain from the immunization. The pain was always last as they would have been too upset for the other conditions. There were several problems with that study. The two‐month‐olds were totally unsurprised by the jack‐in‐the‐box, and very few infants cried in all three conditions, although enough to analyze. There was a pain cry which was high pitched, long in duration, and dysphonated, which is heard as harsh. ⁴ , ⁵

However, I had wandered from the initial request about infants in the NICU, the ones undergoing numerous painful procedures, as opposed to healthy infants receiving an injection every two months. Two things became apparent in my multi‐dimensional approach. First of all, sick preterm neonates tend not to have the energy to cry and are often intubated, and secondly, they are (hopefully) bundled, so that you cannot see body movements. So, I decided to refocus on that population.

At the time, I was most fortunate to have Bonnie Stevens as my first PhD student. I must say that it was with her arrival that my productivity increased dramatically. Having bright, productive students is something all researchers should strive toward!

I was able to obtain funding again to study pain in infants, this time, in the NICU. Bonnie and I shared the data from the cohort of infants from 32‐ to 36‐week gestational age. In this study, we exposed infants to a sham heel lance in which heel was warmed and wiped with alcohol, and a cotton‐tipped swab is applied to the heel; then, the heel is squeezed, and motion made as though applying an adhesive dressing. The real heel lance was compared to the sham heel lance in a cross‐over design on different days. Bonnie used data from the heel lance condition for her work, ⁶ , ⁷ , ⁸ and I looked at the different response to conditions as well as the change over time. I was also very fortunate at that time to work with Ken Craig and Ruth Grunau in examining approaches to pain measurement. ⁹ , ¹⁰ I had to confess that data were suggesting that facial expression, not cry, was a more discriminative parameter of the pain response. Ken suggested that the cry was a signal, like a siren to gain caregivers attention, and facial expression communicate what state the infant was in Ref. 11.

Bonnie and I worked with our data and developed the premature infant pain profile ¹² which she has since tested multiple times so that it now has become a standard of pain measurement. She also tested it in older infants and for its clinical utility. It has undergone one revision to account for very young infants who may not show a response to pain. ¹³ There are a couple of unique things about the PIPP that account for the success of it. First of all, it incorporates two factors of gestational age and behavioral state at the time of the procedure, both of which impact pain response. Secondly, not widely known, the cutoff points for scoring were derived from actual data from over 100 infants, which showed a quadrimodal distribution, accounting for scoring on the PIPP of 0, 1, 2, and 3. That is, the scoring was not chosen arbitrarily, but empirically.

We noticed that some infants showed absolutely no response to a tissue‐damaging procedure, and we wondered whether there were factors that could account for that. We examine a data set from a control condition of 120 infants. We examined age, Apgar score at 5 minutes, severity of illness, sex, race, wake/sleep state, previous study sessions, total number of painful procedures since birth, and time since last painful procedure in a logistic regression. Younger age, both gestational and postnatal, sleep state, and shorter time since last procedure predicted no response. ¹⁴ Other studies had reported on age and state, but none had examined time since last procedure.

Although my major population was with preterm neonates, yet another bright PhD student, Manon Ranger, looked at infants in the pediatric intensive care unit (PICU) undergoing painful procedures. She used a new method, certainly new for pain in infants, to gain some glimpse of sensory cortical activity in response to pain, near‐infrared spectroscopy (NIRS). ¹⁵ NIRS is noninvasive and can access activity of the infant cerebral cortex through cerebral bloodflow calculations of oxygenated vs nonoxygenated hemaglobin. Thus, the amount of activity in the somatosensory cortex of the infant can be determined and has been shown to be sensitive to noxious stimuli in infants. ¹⁶

3. PAIN MANAGEMENT PRACTICE

Although there were studies emerging that suggested there were important consequences to unmanaged pain (more detail below), it seemed as though there was still little being done for babies in pain, particularly for minor, but frequent procedures. Along with Judi Collinge and neonatologist, Jack Aranda, we conducted a study across Canada with 14 NICU’s to examine pain management practices. ¹⁷ Shockingly, less than 1% of procedures were given medication for painful procedures. This was before nonpharmacological studies had demonstrated efficacy. Twelve years later, I conducted a follow‐up survey across 14 NICU’s in Canada, not all the same as the first survey, and found that practice had improved with approximately half of all procedures being treated, all but 15% with nonpharmacological methods including sucrose which by that time had been demonstrated to be efficacious for a single procedure. ¹⁸ One finding that particularly interested me was that a factor predicting whether or not interventions were used was when the parent was present, their being there increasing the likelihood of management.

Another bright PhD student working with me, Margot Latimer, studied factors predicting pain management practice among NICU nurses. While expecting that multiple admissions during a shift or nurses education level and such factors to explain variation, she found that the leadership in the unit was predictive. ¹⁹ The more collegial and less hierarchical the nurse‐physician relationship, the higher the degree of pain management practice by the nurses.

4. CONSEQUENCES OF UNTREATED PAIN

In the late 1980s, Sunny Anand published two seminal papers that unequivocally showed that untreated pain in neonates undergoing surgery resulted in major hormonal and metabolic stress responses that contributed to increased morbidity and even mortality. ²⁰ , ²¹ These studies, along with baby Jeffrey Lawson, who died following cardiac surgery with no anesthesia or analgesia, and whose mother, Jill Lawson, published widely her baby’s completely unethical ordeal, brought the treatment of pain into the public and policy maker domain. There was newfound interest in the topic with such bodies as the American Academy of Pediatrics publishing statements about treating pain in infants.

While profound, Sunny’s studies and baby Jeffrey Lawsons needless tragic death, they did not address the daily pain that nonsurgical patients in the NICU were experiencing. Maria Fitzgerald started her pivotal series of studies demonstrating the long‐term consequences of minor procedures in infants and, perhaps more importantly, showed the developmental vulnerabilities of the preterm neonate. ²² , ²³ , ²⁴

I decided to examine the effect of being in the NICU over 4 weeks. ²⁵ I recruited two groups of infants, both 32‐week gestational age; however, one group was four days postnatal age (younger) and the other group was four weeks postnatal age. We examined the pain response and regressed factors including gestational age at birth, 5‐minute Apgars, birthweight, severity of illness, and number of painful procedures on the pain parameters of the PIPP. The older infants had a higher physiological response, that is, higher heart rate, lower oxygen saturation levels, but lower facial action expression. So, we were able to document clear changes in response over time including inability to appropriately mount a physiological response and to robustly communicate state through facial actions.

Recognizing the difficulty that I had with conducting human studies that clearly showed brain changes, this being before brain imaging studies on infants, I embarked on some animal studies with my brilliant colleague, Dominique Walker, a developmental neurobiologist. While on sabbatical in 2000, I spent time in her laboratory, her rat nursery, to learn some of the techniques used in animal models and to actually participate in the design as well as the conduction of a study to examine long‐term consequences of pain. We were particularly interested in pain sensitivity following repeated neonatal pain, mimicking experience in NICU’s. In our design, we had three groups of newborn rat pups. One group was never disturbed from the nest, and another group was simply removed from the nest and dam for 15 minutes four times daily. The third group was removed and given a pawprick with a 26 g needle and replaced in next 15 minutes later. We included the simply separated group as earlier studies had not controlled for maternal separation. We tested at ages equivalent to adolescence, adulthood, and senior age on thermal sensitivity and inflammatory pain response. There was no difference in inflammatory pain response but the separated only group had lower thresholds than the pain group, which we could not explain. When we reviewed the videotapes and counted maternal grooming behaviors when the pups were returned to the nest, we discovered that the pain group received one and a quarter times more grooming than the separated only group. When this was factored in, the pain group had a lower threshold, as has been predicted. ²⁶ , ²⁷ , ²⁸ This led to an “ah‐ha” moment, which I will elaborate on later in the next section.

We followed up these studies by examining the influence of maternal grooming on pain response ²⁹ , ³⁰ and continued to note that there was a blunting effect on long‐term responses with maternal influences.

5. PROCEDURAL PAIN MANAGEMENT

We were becoming aware of the hazards of using opiates with preterm neonates ³¹ and were searching for alternatives. Topical anesthetics were a group of drugs to explore, Eutectic Mixture of Local Anesthetics (EMLA) cream being one of promise. ³² , ³³ , ³⁴ We had used it ourselves in a study on circumcision. ³⁵ Along with Bonnie Stevens and two neonatologists/pharmacologist, we were funded to study its use for heel lance pain management. Somewhat to our surprise, but EMLA was not effective. ³⁶ A group is Sweden reported that EMLA did not have an opportunity to bind in thin infant skin. ³⁷ , ³⁸

We were also aware of the blunting of pain response with sweet taste in both animals and full terms. ³⁹ , ⁴⁰ We then focused on sucrose. I did a few studies on sucrose, examining timing and dosage, ⁴¹ and comparing to other interventions such as rocking. ⁴² With Bonnie Stevens as principal investigator, we investigated the addition of sucrose to other developmentally sensitive interventions such as prone position or pacifier. ⁴³ All of these studies and of others had studied sweet taste, predominantly sucrose, for a single event. Since it was showing to be highly effective, it was being used more and more in NICU’s. However, I was concerned about its continued analgesic effect as well as whether or not it would mitigate long‐term consequences of repeated pain. We conducted a study of 107 newly born infants who were less than 31 weeks gestational age who would receive 1% sucrose or placebo for every painful procedure in the first week of life. Our primary outcome was three parameters of the Neurobehavioral Assessment of Preterm Infants (NAPI), namely motor development and vigor, alertness, and orientation at 32‐, 36‐, and 40‐week gestational age. We fully expected the infants receiving sucrose to do better, but not only was there no difference between groups, when examining the sucrose group, the greater the number of doses, the lower the developmental scores. ⁴⁴ This was the first study to indicate that sucrose was not the unequivocal answer to procedural pain.

Since sucrose was a mainstay of procedural management of pain, and some studies had found no problem with it, we decided to do a secondary analysis on the data set to see if there was a threshold of doses, below which the developmental scores were within the norms. We found that infants who received less than 10 doses of 0.1 mL 24% sucrose per week were within 2 SD of normed means of the NAPI. ⁴⁵

Marilyn Aita, another bright PhD student, studied the effect of environmental noise and light on pain response. She had worked in a NICU and had particular interest in Developmental Care, which is based on decreasing environmental stimuli stressors, among other practices. In her study, infants were outfitted with masks and earmuffs to blunt these extraneous stimuli, since the layout of the NICU did not allow for randomization with or without stimuli. The outcomes were indices of physiological stability, primarily heart rate variability. Unfortunately, the masks and earmuffs were distressing to the infants, so that other means of reducing light and noise need to be found. ⁴⁶

6. ITS ALL ABOUT THE MOTHER

Above, I mentioned the “ah‐ha” moment in our animal study when we realized that maternal grooming blunted the effects of pain. I also mentioned above that pain management was more likely to be given to an infant if the mother was there. I had anecdotally noted that babies’ oxygen saturation level increased and their heart rates decreased when a parent was beside the incubator touching them. I tried to study that by having a mat on the floor beside the incubator that had a sensor to turn on camera and capture not only behavior but heart rate and oxygen saturation level. The person stepping on the mat was to identify themselves as nurse, doctor, etc or mother, father. The machinery would also turn on for 30 seconds every 5 minutes when no one was there in order to have baseline data. Unfortunately, this study failed utterly in that nurses were straddling the mat to avoid being recorded!

I had also heard about Kangaroo Care, or more technically, skin‐to‐skin care as an alternative to incubators for preterm neonates in resource‐poor countries. ⁴⁷ , ⁴⁸ Putting together my observations of the rat pups and their mothers as well as knowing of Kangaroo Care, I submitted for funding to study its effect. Just as I received word of success of funding, a study was published with full‐term infants undergoing injection that showed its efficacy. ⁴⁹ Our first study was with infants 32‐36 weeks of age, as we thought younger infants may not have endogenous mechanisms developed enough to be invoked by Kangaroo Care. We found that it was efficacious. ⁵⁰ We then decided to study it with younger infants, that is, 28‐32 weeks and were happy to find that it was also efficacious in this group. ⁵¹ At this point, we had decided to no longer have no treatment control group as there were enough data for either sucrose or kangaroo care that it was unethical to withhold. ⁵² We then conducted studies on comparing kangaroo care to enhanced kangaroo care, in which the mother rocked, talked or sang to the baby, and offered her finger for the infant to suck. There was no difference between the conditions. ⁵³ In some instances, mothers were not able to be present, so we started to examine other types of kangaroo care, even just using the mothers recorded voice, which was not efficacious, ⁵⁴ possibly because the recorded voice was too loud, which we had set to be above ambient noise, which says something about the ambient noise. We noted that at times, fathers or grandmothers would volunteer to do Kangaroo Care when the mother was not available. We then embarked on studies of fathers compared to mothers and mothers compared to other women, not related to them, since grandmothers and maternal aunts share some characteristics such as scent and voice. In both instances, the mothers were more effective than others. ⁵⁵ , ⁵⁶ As mentioned above, we did not have a no treatment control group, but the pain scores from historical controls were much higher than either fathers or nonrelated women.

While conducting these studies, yet again I was fortunate to have a bright PhD student, Marsha Campbell‐Yeo who studied the effect of being cobedded with the twin in multiple births. Since these babies had been together since conception, often sharing the same amniotic sac, touching each other, we wondered whether continued care with the twin would be comforting. Using the standard of care, sucrose, as the control, we compared pain response in twins who were or were not cobedded. The pain scores were not different between the two groups of twins, but the time to recovery was less in the cobedded group ⁵⁷ as was the cortisol response. ⁵⁸

Again in consideration of clinical conditions in which infants might be too young or unstable to go into Kangaroo Care, I looked for other possibilities. For very tiny infants, who are disturbed by cutaneous stimulation of any type, I decided to study Therapeutic Touch, in which direct physical touch does not happen, but rather energy fields are accessed by the therapist. The study was conducted in such a way that if we had positive results, there could be no source of bias: A site in Sweden allocated condition and only the Therapeutic Touch nurse had access to the code, and she either conducted Therapeutic Touch or stood by the incubator doing math calculations in her head with the curtains pulled around her. There were two cameras: one focused on the baby’s face for coding and one on the nurse for validation of the procedure (which were never viewed), and heart rate and oxygen saturations were obtained through clinical monitors. There were absolutely no differences between the groups. ⁵⁹ The plots could have been superimposed. I remain skeptical about the effect of Therapeutic Touch, although people I highly respect are proponents of it.

Given our studies and the number of other studies on Kangaroo Care for pain that were coming out, we decided to do a Cochrane review on Kangaroo Care for procedural pain. We wrote one review ⁶⁰ revised it ⁶¹ and are currently (year 2020) revising it to include newer studies. It is clear that it is effective as a means of preventing response from procedural pain in both behavioral and, somewhat less, physiological parameters.

We were also wanting to determine whether Kangaroo Care remained efficacious over time, whether it was as good as the standard of care, sucrose, and whether there were longer term developmental differences. We compared three randomized groups in three heel lances spread across the entire NICU stay: 24% sucrose alone, Kangaroo Care alone, or the combination of sucrose and Kangaroo Care. There were no differences in pain responses nor in developmental outcomes. ⁶² We concluded that since Kangaroo Care alone was as efficacious as the standard of care, and the addition of sucrose did not improve on any outcomes, that it should become the standard of care. We are continuing to analyze that database to examine amount of time in Kangaroo Care and even effects on epigenetics of hormones.

7. FUTURE DIRECTIONS

Being this far in my career, I am often asked to comment on future directions for research on pain in neonates. In actual fact, I cannot predict the future and trust that my younger colleagues will continue to work on it so as to alleviate suffering in our tiny patients. The few comments I do have are more general.

In terms of the quest to measure pain and not another state, I am not certain that such a thing is possible, because I am not certain that pain is a differentiated sensation in humans of any age, especially those with immature sensory processing mechanisms. If you consider that in the adult literature, there has been an ongoing search for some way to differentiate chronic pain from depression, but more recently, there is an acknowledgment that not only do the co‐exist, they might be the same. Similarly, for neonates, any high level stimulation, be it noise or light or pain, will cause distress which may be painful.

The effect of the mother is only recently being appreciated. We need only look at other mammals to see the profound comforting effect mothers have. Our recent studies of maternal (or other caring persons) comfort using ventral skin‐to‐skin contact is only the beginning of ways in which mothers and other caretakers can be more involved in reducing pain. The study on maternal voice that I conducted which had negative results should be repeated with appropriate sound levels. Maternal scent should be further explored. Basically, parents need to be more involved in caring for their preterm neonates. With acute observations, ideas might emerge for study.

Finally, the best knowledge is useless unless it is implemented into care. Much work is now being conducted on evidence‐based care. I applaud and encourage people engaged in that work because that is the ultimate goal of the knowledge generation.

ANALYSIS

This absolute brainlet starts out by verifying all of the aforementioned papers in that it was widespread belief that babies didn’t feel pain and that pain management was rarely given. She happened to have this wild thought about pain after working in an adult burns unit and then looking at babies crying. She made the incredible discovery that because adults could yell “My burns fucking hurt you stupid trollop go get me some morphine” and indeed babies couldn’t because they hadn’t developed the involuntary nervous reflexes to yet (Jokes), maybe it wasn’t so clear cut that those cries weren’t actually them saying “I fucking hurt you stupid trollop go get me some morphine” in baby language.

Our befuddled heroine then goes on a Don Quixote style adventure on figuring out whether indeed babies cries signify pain or not. She interestingly chose the pain from vaccination as the benchmark for something that we can all agree would make a baby cry an actual pain cry, because you’d have to be a psychopathic monster to not admit jamming an needle in the thigh of a baby would not injure them, amiright?!

Problem is that this wasn’t good enough for our heroine because some of the babies that she dealt with were tortured, I mean Intubated and their movements restricted so that her criteria for measuring pain which was their body movements were not able to be seen. So with a nice funding grant (YEY!) she teamed up with a bright young baby pain enthusiast who then conducted another study this time using the heel prick test as a bench mark for when we can all agree that intentionally puncturing the feet of a newborn should cause them to “real cry”.

Get this plot twist though “ In the late 1980s, Sunny Anand published two seminal papers that unequivocally showed that untreated pain in neonates undergoing surgery resulted in major hormonal and metabolic stress responses that contributed to increased morbidity and even mortality”. I mean who would have thunk it that that openly torturing babies and interpreting their cries as those similar to being frightened by a Jack-in-the-box would have lead to them being injured and killed!! This lead to her “Eureka!” moment when instead of looking at babies crying she turned to rats because their behavior is a more accurate representation of humans… than humans. She noticed that if you separate newborn rats from their mother they don’t like it and were better when they were with their mother (Genius stuff I know).

So her journey concludes, after 4 large grants to study the topic, that babies if they do feel pain will be better off being next to their mother whilst they are in pain and may not make as much of a fuss as if they are tied to a gurney and intubated. It was the workings of a medical genius, a heroine sent from the lord above to ease the suffering and pain that the medical establishment (she was milking for grant money) were causing to little innocent babies.

Why Are They In Pain In The First Place?

We are discussing here really just the instance that the medical establishment have decided that a baby needs some sort of medical intervention, surgery and the like and whether or not they need anesthetic or pain relief. Now I vaguely understand the call that ,given this absolute monstrosity of an establishment aren’t to be trusted, should they give morphine, sedatives or other dangerous drugs to babies as it might have detrimental effects. OK that is a good thought that maybe more drugs and more medical interventions will makes things worse, i.e more of their barbaric ways should probably limited, that sounds sensible.

But more than this, at no juncture does it dawn on these cretins that potentially these kids might not have to have these surgeries in the first place, or even they are having these things because of their allopathic death cult in the first instance. Obviously this subject could be about 10 articles in and of itself about fraudulent diagnosis in the first place, like claiming kids have cancer and things, so I can only really hint at this first step:

NHS Resolution’s Annual Report and Accounts for 2024/25, published today, highlights a record 83% of clinical claims being resolved without the need for legal proceedings.

In line with NHS Resolution’s strategy to keep patients and healthcare staff out of court, this means that 11,110 clinical compensation claims were resolved through dispute resolution processes rather than formal legal proceedings – the highest percentage ever achieved.

The report also describes how innovations such as NHS Resolution’s ‘Early Notification’ scheme for birth injury have enabled families to access compensation for immediate needs more rapidly. It also explains how NHS Resolution has worked with families and their representatives to ensure their involvement throughout the compensation process.

NHS Resolution received 14,428 new clinical negligence claims and reported incidents in 2024/25, reflecting ongoing broad stability in overall claims volume across recent years.

£3.1 billion was paid out in 2024/25 for compensation and associated costs on all of NHS Resolution’s clinical schemes, compared to £2.8 billion in 2023/24. £1.3 billion of the total clinical negligence payments in 2024/25 related to maternity.

The estimated ‘annual cost of harm’ for incidents in 2024/25 for the main clinical scheme, Clinical Negligence Scheme for Trusts (CNST), was £4.6 billion, down from £4.8 billion in 2023/24. This reduction reflects updates to discount rates and improvements in long-term inflation assumptions.

Demand for NHS Resolution’s expert Practitioner Performance Advice service continued to grow significantly, with 1,420 new and reopened requests for advice – a 24% increase on 2023/24. Requests for NHS Resolution’s Primary Care Appeals service to deliver fair and prompt resolution of appeals and disputes increased significantly, with a 31% rise in the number of cases received.

NHS Resolution’s provision for future liabilities as of 31 March 2025 was £60.3 billion, compared to £58.5 billion in 2023/24. The increase reflects another year of activity and natural growth, partially offset by changes to the Personal Injury Discount Rate (from -0.25% to +0.50%) and updates to HM Treasury discount rates.

ANALYSIS

Just so we are clear here, this sum of £3.1 Billion in damages paid out to over 11k people was for Negligence and Malpractice in the Maternity ward in one year in one country. This absolutely jaw dropping figure suggests that the real scale of damages and malpractice is astronomically higher. So lets just put into perspective that these idiots in scrubs are staring at newborns trying to figure out if their facial expressions can tell them whether they are in pain from an unnecessary surgery just performed or trapped gas. That they are also, when all is said and done being found medically negligent in 1 in 30 births. Doesn’t exactly fill you with trust, does it?

CONCLUSION

I have been accused rightly or wrongly for over generalizing large complex areas of Science. When it comes to things like the “Virus” question many people berate me for planting my feet and saying “Viruses Do No Exist”. It’s fine to me that you want to say “there is no evidence for Viruses” and respect that is however you feel most comfortable in backing your statements. I use that phraseology for exactly those functions; “backing your statements”, for as I have always remained consistent here at the Virology Control Studies Project and me as an individual, Jamie, I don’t want to be a source of authority or “expertise” that your thinking is deferred to. The truth works so much better when it is your truth and you know how best to defend and debate and market and live your truth, so ultimately it has to be what you believe in, not me. I am just here to present information that has changed my mind in the world that I experience it.

So my conclusion is an exceptionally easy one when it comes to the information laid out in the article, it is one that will be stereotypically over generalizing and tar an entire industry with a most VantaBlack colour blocking possible. One that experientially I have, so it is not just learned from this bleak look inside the minds of the people I will tar, but combining that with what I have seen and heard whenever I have had the displeasure of “admitting” myself into this institution:

There are two completely separate things that cannot possibly co-exist in this world, it is inconceivable for them to live and breathe and function in an orderly, predictable, efficient, productive way, together, sharing the same earth we tread on. That there can be both people that have attained enough God given wisdom and knowledge and experience about how the Human Body operates and what is best for its health and survival and simultaneously be people that cannot tell that the most precious vulnerable, pristine, innocent and angelic babies whether their cries are signifying pain or not.

It should not really matter the timings of how these events have unfolded and one does, even me, somehow relinquish some of the responsibility when these barbaric practices came from a time before anyone you could have direct contact with would be able to recount the horror of such a deluded scenario as someone that is meant to make you better, actually inflicts pain. Things such as Trepanning of the Skull to release evil spirits went on until the late 19th Century, so just out of touch of our generational pool. We might just look back on those types of practices as gruesome gargantuan mistakes, only to learn that effectively this practice has just been continued on to modern times under the guise of “releasing inflammation”.

The same goes with practices such as Full Frontal Lobotomy, which only saw its official end, last practiced in the 1980s (Must have been a real awakening decade). Once again was this practice really ever stopped or just diversified into chemically poisoning the brain and all of the different branches of “experimental neuroscience” masquerading as “drilling holes in peoples heads and cutting bits of their fucking brain out”.

So the medical system has little changed and really these squeamish fairytale stories of barbarism that are offered up as a comfort blanket of modern human endeavor really should be thought of as cultural wisdoms passed down to the discerning new generation, like “stay the fuck clear of the person telling you they are gonna fix you with a Black and Decker drill and a scalpel in their grip”. I see it as nothing to be ignored, when you hear of any of these historical anecdotes should you not realize they are alive and well right now, this should probably go for the State and centralized human governance in general, but for sake of brevity we’ll stick to health and medical science.

So my personal conclusion to all of this, how my mind has changed in the way that I approach the medical system is to take every single positive claim made about how anyone thinks the body works if not fundamentally apparent and subtitle it with “Yes but you also thought that babies couldn’t fell pain”. Is that unfair? No, not in the slightest. At any one second Celeste could have woken the fuck up out of her Frontal Lobe nullified, zombified, near decade long coma she found herself in and asked “Am I insane to think that we should just assume that babies feel pain, because the things we are doing to them should hurt and they look and sound like they are in pain?”

Should I tarnish people in a medical industry that have been blissfully unaware of Celeste’s moral path to enlightenment of discovering whether her former self was indeed human or not? Yes. For as we have shown many times, is that the State institutions work on protocols and chain of command and systems and legers. To be a part of a system that its core fundamental principles of pain management, like fulfilling their cult cub scout dib dob motto “First Do No Harm” must always be caveated with the raw unmitigated truth that they intentionally caused pain and suffering from the most monumentally cruel, dehumanizing and sick thought process ever conceived.

My mood change over this piece of information not only guided me into at no point submitting myself to the Allopathic Conveyor Belt of death and disease but has also shaped my view point to do with Science, especially obviously BioMedical science and therefore “Bio”Chemistry. I guess this is really where I get my accusations of over generalization from as of yet, I haven’t been particularly specific with a lot of my claims around this topic. I have done a lot more research than I have written articles and have lots to come, so more should be apparent in the future but I still feel that this topic should be caveated with this same sequitur:

If you think that you can synthesize the sun’s actions on a human body, make it into some sort of chemical, squirt it onto a pill and call it an essential vitamin, you are claiming literal God -like status, you are claiming that you can refine and harness the bringer and giver of all perceived life. That’s quite a bold claim, especially when you give those same pills to rats, they die (But that’s for another article). No even in that claim you must caveat that with the fact that these people who think they know everything about how the human body works, studying them with all of their machines and instruments, never had a single bleep bloop detector going on that said “Maybe babies aren’t just displaying involuntary nervous spasms when they cry and are actually experiencing pain?”.

I think it is fair to caveat all of these things with this disclaimer. I am not saying this should be the only point of reference to hold against them, but certainly when these topics are uninvestigated, or you hear new areas of Soyence emerging on the interwebs “Soyentists have discovered a new way to engineer the proteins in a Cane Toad’s tail that when boiled and eaten can instantly make you understand and speak Spanish” you think… ok…. that sounds marvelous, but given that you, as an entire Western Medical Establishment decided that Babies couldn’t feel pain until a couple of decades ago, I think we can pass it off as a crock.

SO where does that leave us for our positive thinking about health? It is all well and good sitting back in an armchair and calling everything “Fake And Gay”, but does this line of thinking help in anyway with our health? To that I would say, yes. For I think, and it is my opinion in health that there are two fundamentals; the understanding that your body is beautiful and if given the time a space to heal, it will do so to the best of its capabilities. But the second point that I think applies here is about discernment and truly listening to yourself and your body.

The market is flooded with nutritional advice and what you should and shouldn’t be doing to maintain your health. I can first, instantly disregard all the quacks that go down the “Sunshine Pills” route, any supplements at all for the aforementioned reasons. But ultimately I don’t know what nutrition is best, if I were to make a guess I think everyone needs a different nutrition. So it is incumbent to be able to listen to your own body, be attuned to it and recognize what seems good and what seems bad over both the short and long term. So I think that drowning out the noise of institutions telling you that you need a hole in your head and your baby is not proper crying, is a perfect way to actually switch on discernment and responsibility to learn about something so very personal as the topic of health and be able to apply that to oneself and most importantly to be applied for ones children.

Sorry for this sad topic, but I hope you have gained some insight from it.

Peace and Love.

J

If you have enjoyed this article and want to support the project with a one time donation please BuyMeACoffee, thanks!

This article is available as a downloadable EBook along with the rest of my work on ShadowBanned Library

Gonna smash this Emergency article out (apologies for any more than usual frequency of typos and terrible grammar) as I think it works best when challenging the narrative as we saw was put to good effect with the Meningitis Hoax in the UK. I think as a collective we managed to counter extremely quickly and hopefully save some kids from getting the toxic vaccines or even worse submitting themselves to the allopathic death cult of Modern Western Hospitals.

It Ain’t Contagious

With the recent strain outbreak on the cruise ship Hantavirus is not contagious human to human, correct? Short Answer

Understood—and in that context, the key point is:

If this is a non-Andes hantavirus outbreak (as is overwhelmingly the case in Europe and similar cruise-related investigations), then:

No — it is not considered contagious human-to-human, even in close settings like a cruise ship.

Cruise ship cases typically trigger concern because of shared ventilation and close quarters, but hantavirus transmission (for these strains) still requires contact with infected rodent urine, droppings, or saliva, not other passengers.

So the accurate, situation-specific answer is:
No human-to-human transmission is expected for that outbreak strain.

Let’s tackle this first head on when they wheel out the “Expert” who (Ironically) breathlessly tells us we should be extremely worried about Hantavirus because it has “a long incubation period of up to a week”. As we can see above and even our wheezing academic tells us in mealy mouthed terms, that Hantavirus is not Contagious, Human to Human. So off the bat, unless you were paying attention you wouldn’t realize that his opening gambit was a massive fucking lie. He was trying to insinuate that you should be scared because potentially people could be “infected” for long periods of time and you could “catch” this hemorrhagic death “virus” and bleed out. Well it doesn’t spread human to human according to their own science so you have either (according to them) licked some Rat Piss (No Alec) and your kidneys are imminently gonna melt, or you didn’t and you will be just fine.

SCAMDEMICABILITY?

What is the IFR of Hantavirus?

There isn’t a single IFR for “hantavirus” because it depends heavily on the species, but broadly:

• Hantavirus Pulmonary Syndrome (HPS) (Americas):
  ~30–40% fatality rate (often cited as IFR in that range for symptomatic cases)

I am secondly here to alleviate the fear of them trying to run with this as a Scamdemic. We can never be 100% sure given that the entirety of Soyence is invented storytelling that at any given moment they could completely change the story, but for now and as it stands, they wanna try and claim that if you lick a rat with da Virus it is almost a 50/50 as to whether you live or die. So there is no way they can “spread” this hoax very far, as Asymptomatic Hemorrhagic Fever would be a tough sell to Dave down the pub (The yardstick for Scamdemicability).

MAGIC RATS

🐀 How many rats carry hantavirus?

• In wild rodent populations, typically 1% to 15% are infected at any given time.

• In some “hotspot” areas, it can rise to 30–50% or more.

• Different species carry different hantaviruses—for example:

  • The deer mouse (common in North America) carries Sin Nombre virus.

  • In Europe (including France), species like the bank vole carry Puumala virus.

So the short answer: a minority of rodents carry it, but it can be quite common locally.

---

🧬 Do rats (or rodents) die from hantavirus?

Surprisingly, no—most of the time they don’t.

• Rodents are the natural hosts of hantaviruses.

• The virus has co-evolved with them, so:

  • They usually don’t get sick

  • They don’t die from it

  • They can carry and shed the virus (in urine, droppings, saliva) for long periods

how are they immune to it?

Rodents aren’t “immune” in the sense of killing the virus off completely. What they have is more like a built-in tolerance—their bodies let the virus persist without causing damage.

So lets look at the epidemiology of this thing and you will quickly see how this story is complete fucking garbage even using their own metrics. They claim that in certain areas that 50% of rats harbor this kidney smoothie making “Virus”. So given there are estimates of between 10 and 100 BILLION rats on earth and in most Urban areas you are said to be within a close proximity of a rat at all times, according to the science, humanity must have died out 1000 years ago.. Instead we didn’t and it was just Gene Hackman’s wife (More on that to come).

Why The BOATS?!

Did some scrabbling around on ChatGPT which over the course of the last two months has become increasing more argumentative, deceptive and downright moody with me.. (Like I need more teenage kids in the house).

One thing that was very interesting to me was getting it to fess up on the amount of people that die on board Cruise ships. You see it should be fairly obvious that the average age of Cruise ship goers is vastly skewed toward the Retired population. Many of those are treating this as their “last venture” out. So one would imagine that the natural attrition rate that you get on these cruises “should” be a little high. Apparently not according to Chat GPT, apparently the death rate is 100X LESS than it should be for just the amount of person hours aboard cruise ship (MASSIVE Red Flag):

Right so find me the exact number of people who died on cruises in 2019

There isn’t a single perfectly exact audited number published in a way governments track aviation accidents, but there are peer-reviewed and industry-compiled estimates for 2019, and they converge pretty well.

🚢 Cruise ship deaths in 2019 (best estimate)

From aggregated cruise industry and academic datasets:

👉 ~125 to 175 total deaths worldwide on cruise ships in 2019 (passengers + crew)

One structured dataset gives:

• ~140–175 deaths in 2019 across ~30 million passengers

• Academic review data shows ~27 passenger deaths + 10 crew deaths reported in 2019 in a sampled registry (not full global coverage), consistent with a low hundreds total when scaled across all lines

So the consensus range is:

✔ ~130–170 deaths in 2019 (most commonly cited range)
✔ Occasionally rounded as “~150 deaths”

Expected deaths are 5000 a year but that will be much lower because you haven’t accounted for the age skew on cruises

You’re thinking in the right direction about age skew, but there’s a key correction: we don’t actually expect “~5,000 cruise deaths/year” once the exposure is modeled correctly. That earlier figure came from an over-rough scaling step.

Let’s reset this cleanly.

---

🚢 1. What we actually know (anchors)

• Cruise passengers per year: ~30 million boardings

• Average cruise length: ~7–10 days

• Total exposure: ~0.7–0.9 million person-years (not 30 million person-years)

That part is fine.

---

👵 2. The age issue (your point)

Yes:

• Cruise passengers skew older (often 50–75+)

• That increases baseline mortality compared with a general population

But not as much as it seems, because:

Important correction:

Cruise passengers are not representative of “all elderly people”
They are:

• healthier than average for their age

• mobile enough to travel internationally

• screened informally by self-selection (and sometimes medical advice)

So the relevant comparison is:

“healthy older travellers,” not “general elderly population”

---

⚖️ 3. A more realistic mortality rate

Instead of using ~0.7% (all-ages average), a better bracket for cruise demographics is:

• ~60–80 years old, relatively healthy travellers:

  • roughly 1–3% annual mortality equivalent if they were followed for a year

But they are only exposed for ~10 days.

So we scale it down:

---

🧮 4. Proper back-of-envelope model

Let’s take a conservative cruise-relevant mortality rate:

Step A: annualised rate for cruise-age population

r≈0.02r \approx 0.02r≈0.02

(2% per year equivalent)

---

Step B: exposure time fraction

Step A: annualised rate for cruise-age population

r​≈0.027

---

Step C: expected deaths

30,000,000 x 0.027 x 0.02 = 16,200

This looks large — but this is still a naive application assuming independent “population risk”, which is not valid because:

• passengers are not continuously “at risk in a closed mortality system”

• most deaths in that age band are chronic progression over time, not short-window events

So we must adjust for time-to-event mismatch.

So if we take the amount of person hours on board these cruise ships that they claim are taken by 30,000,000 people a year then just the standard rate of attritional, natural death should be 16,200 people. Obviously there are massively complex calculations and variables that would limit this and it is entirely person to person, but still given that they cited that just 150 people died on Cruise Ships in 2019, we can see that these statistics are most definitely Gulfs apart.

So how and why? Well I would reckon it is just a factor of death certificates and news reporting. You may get lots that have heart attacks, are gravely ill get dropped off at landfall and processed in hospital as a land based death. That is what I would imagine happen in most cases whether they die on the boat or just barely make it. This I would say when it comes to the Rat Suck “Virus” they are going to twist that narrative that a fully jabbed Octegenarian has a turn for the worst, gets carted off at the next port and snuffs it at the hospital is chalked off as a seafaring kidney casualty.

This works as the perfect propaganda pieces. What is more scary than being trapped on a Boat with a 40% death chance when you know there is a rat with radioactive piss on board. It conjures up all sorts of nightmares and will hopefully eventually be written as a sequel to Snakes on a Plane. This combined with the easy ability to present fraudulent statistics - Look we have just seen a 100 fold increase in boat deaths this year ( By changing where the deaths were recorded) and you have an easy win.

LABORATORY CONFIRMED CONTAGION?

So there is no Human to Human transmission of Hantavirus, but surely they have proof that breathing in a rat’s guff or taking a little tipple on a rat’s golden elixir (No Alec) with make people desperately sick? If you don’t already know the answer to this, you must be new to the Virology Control Studies Project:

Have there been any controlled human infection models of Humans with Hantavirus?

Short answer: No—there are essentially no controlled human challenge (intentional infection) studies with hantaviruses. And that’s very deliberate.

---

🧪 Have humans ever been deliberately infected in experiments?

• There are no ethically approved human challenge trials where researchers intentionally infect people with hantavirus.

• All human data comes from:

  • Natural outbreaks

  • Accidental exposures

  • Observational clinical studies of infected patients

For example, studies of patients with hantavirus infection track immune responses during real illness, not induced infection.

---

🚫 Why no human challenge models?

There are a few strong reasons:

1. High severity and mortality

• Some hantaviruses cause life-threatening disease:

  • Hemorrhagic fever with renal syndrome (Europe/Asia)

  • Hantavirus pulmonary syndrome (Americas), which can have ~40% fatality rates

That alone makes intentional infection ethically unacceptable.

---

2. No reliable treatment or reversal

• There is no widely effective antiviral cure

• Treatment is mainly supportive care (ICU, oxygen, etc.)

In human challenge studies (like malaria or flu), there’s usually a clear rescue therapy—that’s not the case here.

Of course there are no studies what so ever in humans to back up any of their claims, the entirety of the science is based purely on a “Trust Me Bro” basis. They use the vaguely logical but still no real excuse that they have made such a preposterous claim that the death rate is 50/50 they couldn’t give people a lick on a rat’s tit without them dying. Just to add you will see, there is also no cure or “vaccine” for this non existent “virus” which puts into perspective even more the absurdity of their claims of the amounts of rats harboring this Grim Reaper “Virus”.

So they have animal models where they makes them sick with a shot of the rat’s Yellow Gold? Of course they do! Phew! These guys wouldn’t want to miss out on a bit of animal torture and ritual sacrifice, what are you dumb!? So funnily enough given that Rats are totally fine with Hantavirus (They just have a tolerance according to the priests in white coats, duh), they can’t use the standard lab rats for their torture… strangely enough they they do claim to be able to use a rodent, a Syrian Hamster (No further questions please).

They Don’t Actually Die

With these animal models are the animals euthanized and they are then assessed for infection?

In most hantavirus animal studies, yes—animals are often euthanized at planned time points or at humane endpoints, and then tissues are analyzed for infection and disease effects. But it’s not “just infection then killing”; it’s more structured and regulated than that.

---

🧪 What typically happens in hantavirus animal models

1. Infection phase

Animals (commonly:

• Syrian hamsters

• mice (including genetically modified strains)

• sometimes non-human primates)

are experimentally infected with hantavirus under controlled conditions.

---

2. Monitoring phase

Researchers then track:

• weight loss

• temperature

• breathing and behavior

• survival (in lethal models)

• viral shedding (if applicable)

---

3. Endpoints: two main types

🟡 Humane endpoint euthanasia

Animals are euthanized early if they become too sick, for example:

• severe weight loss

• respiratory distress

• inability to eat/drink

This is required by animal ethics regulations (EU/US/UK frameworks).

---

🔴 Scheduled euthanasia (planned sacrifice)

Even if animals are not sick, they are often euthanized at set time points, such as:

• day 3, 7, 14 post-infection, etc.

This allows researchers to:

• measure virus levels in organs

• study immune response over time

• examine tissue damage under a microscope

---

🔬 What is analyzed after euthanasia?

Once the animal is euthanized, researchers typically collect:

• lungs (critical for pulmonary syndrome models)

• kidneys (important for hemorrhagic fever models)

• spleen, liver, brain

• blood serum

They then look at:

• viral RNA levels (PCR)

• infectious virus (culture)

• immune responses (cytokines, antibodies)

• tissue damage (histology)

---

⚖️ Ethical framework

All of this is governed by strict rules:

• “3Rs” principle:

  • Replace (use non-animal alternatives when possible)

  • Reduce (use minimum number of animals)

  • Refine (minimize suffering)

• Mandatory ethical review boards in all major research systems

So euthanasia is not incidental—it’s actually a required part of humane experimental design.

---

🧠 Bottom line

• Yes, animals are often euthanized in hantavirus research

• This is done either:

  • because they reach humane endpoints, or

  • because they are scheduled for tissue analysis

• The goal is to understand infection and immune response in a controlled, ethical way—not to let animals suffer disease progression unnecessarily

This is the big con with these animal studies and it is very useful to highlight this fraud in full HD with the Hantavirus as it is applicable to all Animal Models, especially the modern ones in the last hundred years.

These animals are NOT dying from the things being tested on them, they are being intentionally euthanized either at a predetermined time or they have incredibly low threshold of “symptoms” that trigger their euthanizing, like ruffled fur, slight weight loss or lack of appetite. The Virologist want to move it as quickly as possible away from any sort of observable effect and straight back into their PCR, Antibody, inflammation marker inferences.

So we can draw a line under this one, they have absolutely no evidence whatsoever for their claims that if you happen across a puddle of Rat Piddle you have a 1 in 4 chance you are going to piss out your kidney.

Gene Hackman’s Wife

How did they know Gene Hackmans wife died of Hantavirus? Was she PCR tested?

Short answer: yes — her diagnosis was based on lab testing, and PCR was part of it, but it wasn’t the only thing used.

Here’s what public medical examiner reports and officials have said about Betsy Arakawa (Gene Hackman’s wife):

How they determined hantavirus

Investigators concluded she died of hantavirus pulmonary syndrome (HPS) using a combination of:

• Autopsy findings

  • Heavy, fluid-filled lungs consistent with HPS

  • No signs of trauma or other competing causes

  • Normal carbon monoxide levels

• Toxicology / lab testing

  • Negative tests for influenza and COVID-19

  • Standard toxicology screening did not suggest poisoning or drugs as a cause

• Specific infectious disease testing

  • Blood/tissue testing was done to detect hantavirus infection

  • This type of confirmation is typically done using PCR (polymerase chain reaction) and/or serology (antibody testing) to identify viral RNA or immune response

Officials explicitly ruled out other common causes and then confirmed hantavirus based on the lab evidence plus the classic lung pathology patter.

Right so let’s put this altogether. We can assume that Mrs Arakawa was a Jab enthusiast as she was furiously googling Covid, whilst she had a runny nose. This is most certainly going to fall into the category of WebMD fearing herself into a “low blood oxygen” stupor.

She was posthumously declared a victim of that Rat Piss Grim Reaper based on the irrefutable evidence of: She tested Covid Negative and had fluid on her lungs and dead rats in the attic (We will ignore the fact that Rats aren’t affected by Hantavirus of course- The BBC weren’t to know that)

What makes this story even more ridiculous is next to the chalk outline of the Rodent Piddle’s victim is Gene himself, who died a week later from a heart attack. The mind boggles as the set of circumstances that lead up to this happening… but I guess that is a mystery for the three kids that stand to inherit 90 million bucks (silver linings and all that (Hope the dollar bills aren’t soaked in rat whizz)).

Pictures of the Murderer

So I will leave you with a picture of the claimed Sewer Dwelling Wee Wee Monster so that you can be hypervigilant for its next citing. According to it’s description however it is the exact same shape and size as the images in the bottom picture of Cellular Debris found in the Virology Control Studies Project Uninfected Culture images (Labelled “Hantavirus” for posterity (and comedy value)).

What is the size and shape of hantavirus virion?

Size and shape of hantavirus virions

Hantaviruses are enveloped viruses in the family Bunyavirales, and their particles have a fairly characteristic but somewhat variable structure.

Size

• Typically about 80–120 nanometers (nm) in diameter

• Some variation exists depending on the species and preparation method (electron microscopy can show slightly different sizes)

Shape

• Pleomorphic (not perfectly uniform)

• Commonly:

  • Spherical

  • Sometimes ovoid (egg-shaped)

  • Occasionally slightly elongated or irregular

• They do not have a rigid capsid shape, unlike many non-enveloped viruses

Claimed “Hantavirus”

Cellular Debris in uninfected cultures….. Labelled as “Hantavirus.

If you have enjoyed this article and want to support the project with a one time donation please BuyMeACoffee, thanks!

This article (May be, if I decide to, maybe comment if you want it to be) available as a downloadable EBook along with the rest of my work on ShadowBanned Library

Thank you to subscriber Jeff R for posting me this interesting piece it certainly seems to backup my hypothesis or rather the scientific establishments own data that says that PCR tests are not measuring specific nucleotide sequences but are instead measuring charge:

How many people are HIV positive?

Globally, the most recent data shows:

• About 40.8 million people worldwide are living with HIV (as of 2024)

A bit more context

• Around 1.4 million of those are children (under 15)

• Roughly 39 million are adults

• About 0.7% of adults globally are HIV-positive

Important to understand

• HIV is still a major global health issue, but treatment has improved a lot

• Many people with HIV live long, healthy lives thanks to antiretroviral therapy (ART)

• Around 77% of people with HIV are receiving treatment.

When “In the field” and people are being monitored for their “HIV” treatment, every so often you will find naughty people such as Kevin Brau, friend to the Virology Control Studies Project who wakes up to the scam of Virology and stops taking their harmful Anti Retro Viral Medication that the medical establishment are claiming are keeping them alive. In this and many many other incidence, failure to then register an “HIV” PCR positive (Which should be 100% without ARVs as they claim “HIV” has integrated into their “Genome”) leaves them with severe egg on face.

As the data shows, they claim an absolutely gobsmacking level to the “HIV” fraud that there are some 40million people scammed into believing they have some permanent “Infection” that will kill them unless they hand over money to Gilead. An interesting addendum to this is that HIV.Gov the home for official “HIV” statistics, lists the current number of people that have a claimed “HIV” positive status but are not taking Anti Retro Viral medication is 10 Million. Well, that is a highly encouraging number of control experiments, living, breathing and walking around being a thorn in the side of the medical establishments scare stories for everyday they live on.

These living, breathing data anomalies are a particular problem for the Medical Establishment and Big Pharma (Same thing alert). They claim that “HIV” has permanently integrated into their genome so they should either take their drugs or face a swift death (Fantastic business model if you can find it, right… “Pay us or die”). When there are people that are not listening to these Mafioso tactics and continue to live a healthy (likely more healthy than before) life, they need to find excuses for why this is happening.

The first, which we have covered in a good amount of detail on the Virology Control Studies Project is what they hilariously dub “Elite Controllers”, people whom have magic “DNA” that can do jiggery pokery to the “HIV” to make the test negative without drugs. Interestingly this Magic “DNA” didn’t work in the first place when they got onboarded to the Allopathic Death Cult because they must have tested positive up front to be tracked as an “HIV Infected” individual. A slight variation on this systemic control failure of the PCR, is what they call “Long Term Non Progressors”. They don’t have the Magic “DNA” to make the tests Negative, no their tests are still positive, but what they do have is a slightly different Magic “DNA” that means that the high “Viral Load” of the tests mysteriously do nothing to their health, so they live perfectly healthy whilst the tests are pinging off the charts telling them they are going to be dying any second now.

So we know that they are always on the lookout for fantastical stories to explain away their abject failure in the field. What we are going to be looking at today, very briefly is a new news story that represents yet another one of those scapegoats for failure in the form of a Diabetes Drug, Metformin:

Scientists are investigating why a small number of people with HIV can keep the virus suppressed long after stopping treatment, uncovering clues within the immune system. Their findings point to specific immune cells and genes that help maintain this dormant state.

Researchers found that certain immune cells, genes, and the drug metformin may help keep HIV dormant after treatment stops, offering new paths toward long-term control.

For millions of people living with HIV, taking daily medication is essential for life. If treatment stops, the virus typically returns within weeks.

However, some rare individuals can control the virus for months or even years after stopping therapy, a phenomenon that has puzzled scientists.

“Strikingly, a small number of people rebound much more slowly and take multiple months or even longer to rebound,” says Nadia Roan, PhD, senior investigator at Gladstone Institutes.

New Clues to Long-Term HIV Control

In research published in Immunity, Roan and her colleagues offer new insights into this effect and highlight possible ways to maintain long-term health without ongoing antiretroviral therapy.

One key discovery is that two genes inside infected cells act like protective locks that keep HIV inactive. The team also found that metformin, a widely used diabetes drug, can activate one of these mechanisms to help maintain the virus in a dormant state.

“Our data suggest metformin might be able to delay, or possibly even prevent HIV rebound in some individuals, which is exciting because it’s a very safe and affordable drug,” says Roan, senior author on the study. “We are now very interested in pushing forward with preclinical and eventually clinical studies to directly test these potential benefits.”

Hidden HIV Reservoirs and Rebound Risk

Although antiretroviral therapy can suppress HIV, it does not eliminate it. The virus remains hidden in “reservoir” immune cells that contain its genetic material. If treatment is interrupted, these reservoirs can produce active virus again, leading to renewed symptoms and potentially acquired immunodeficiency syndrome (AIDS).

To better understand how some individuals keep the virus under control, the researchers examined people who maintained suppression after stopping treatment.

They analyzed four clinical trials in which participants paused therapy under close medical supervision, often as part of efforts to test potential HIV cures.

Immune Cell Analysis Reveals Key Patterns

The team studied blood samples from 75 participants collected just before treatment stopped, measuring gene and protein activity across different immune cell types to identify patterns linked to delayed viral rebound.

Their analysis revealed several important findings. In two trials, individuals with higher levels of stem cell memory CD8+ T cells experienced slower viral return. The two participants with the longest delays, more than 22 weeks and over 33 weeks, had the highest levels of these cells.

“These CD8+ T cells appear to have ‘stem-like’ features and might be able to stick around to continue replenishing themselves for prolonged periods of time, which may help them contribute to long periods of ART-free HIV control,” Roan says.

Role of Natural Killer Cells in HIV Control

In another trial, people with an unusual form of natural killer cells also showed delayed rebound compared to those with the typical type. While these cells are known for destroying infected cells, they can also influence how other immune cells function, which may affect how quickly HIV returns.

“Altogether, our findings suggest there’s probably not just one solution for suppressing HIV,” says Ashley George, PhD, research scientist at Gladstone and co-first author on the study. “By leveraging different features of immune cells that can help fight infection, we likely have multiple opportunities to control HIV without the need for ART.”

The researchers also identified important changes in CD4+ T cells, the main type of cell that serves as an HIV reservoir.

Genes That Help Keep HIV Dormant

Higher levels of two genes, DDIT4 and ZNF254, were linked to longer delays before the virus rebounded. Laboratory experiments confirmed that both genes can suppress HIV activity.

“Both genes represent possible new targets for a promising ‘block and lock’ strategy for curing HIV, in which drugs would first be used to block HIV activation, followed by ways to make this block permanent,” George says.

This strategy is central to the work of the HIV Obstruction by Programmed Epigenetics (HOPE) Collaboratory, a research group focused on finding a cure.

Further analysis of existing data supported these findings. Individuals with higher levels of the two genes showed reduced viral activity, and “elite controllers,” people who naturally suppress HIV without treatment, had especially high levels of ZNF254 in their CD4+ T cells.

“One possibility we’re imagining for the future is that we could somehow deliver ZNF254 to infected cells in order to turn people into elite controllers,” George says. “We could also try to engineer an even stronger version of this gene.”

Among all the findings, the link between DDIT4 and delayed viral return may have the most immediate clinical relevance. Levels of this gene can be increased by metformin, something previously observed in other cell types and now confirmed in T cells by this study.

Metformin’s Potential to Suppress HIV

This led researchers to test whether metformin could directly suppress HIV. In one experiment, the drug prevented the virus from reactivating in cells taken from people with HIV, suggesting it could support the “block and lock” approach.

The team plans to continue testing metformin and similar compounds in pre-clinical models to see if they can stop HIV from re-emerging when treatment is paused.

Drugs that keep HIV inactive could also benefit people who remain on therapy by reducing exposure to viral gene products that contribute to chronic inflammation.

“We are excited to pursue HIV silencing strategies both as a way to achieve block and lock, but also as a strategy to improve the overall health of people with HIV by lessening chronic inflammation,” Roan says.

Summary

Immunological mechanisms regulating HIV rebound after antiretroviral therapy (ART) interruption remain unclear. We examined relationships between host factors, HIV reservoir, and HIV time-to-rebound after analytical treatment interruption (ATI) by characterizing pre-ATI peripheral blood mononuclear cells (PBMCs) from 75 ART-suppressed people with HIV (PWH) using high-parameter methods. Across interventional (CLEAR, TEACH, and REDUC) and non-interventional (A5345) cohorts, delayed rebound was not associated with intact HIV. Cohort-specific immune effectors were associated with delayed rebound. RNA sequencing of CD4⁺ T cells from A5345 revealed that the mTOR inhibitor DDIT4 and zinc finger protein ZNF254 were associated with delayed rebound. In vitro and in vivo studies demonstrated that DDIT4 and ZNF254 suppressed HIV expression. Metformin induced DDIT4 and suppressed HIV expression in primary cells and cells from ART-suppressed PWH, suggesting that this affordable diabetes drug could be repurposed to silence HIV. Our results support the pursuit of both immune- and HIV-silencing strategies to achieve ART-free HIV remission.

ANALYSIS

First off the surprising thing is that they managed to find a fairly sizable cohort of “HIV” Positive individuals who were willing to stop their ARV meds. In the name of Soyence and all that I am sure they just put their trust in the priests in white coats, but still it is moving in the right direction that they are not piss scared of doing it.

For this study that is linked in the paper above they took 75 people and stopped ARVs and studied how long it took for them to “Rebound” from undetectable “Viral” load. On the face of it, even this part of the study was very useful as they set the bar for “Rebound” low at 1000 copies and despite this, some of the participants went for nearly 8 months before breaching this threshold. You must factor in that the people on this trial were likely the must gutter form of Pharmaceutical superfans being on this trial and being “HIV” Positive, so it is not likely they are going to be interested at all in naturally detoxing and bringing themselves back to balance (Which is what Elite Controlling is).

Now this trial has gone the typical convoluted route stopping off at their tried and tested course of bafflement in the form of “Genetics” where they make up random numbers and codes based on lab values and claim this has any mark on reality. Oh of course, silly me, the DDIT4 and ZNF254 are expressing like a runaway train in the Long term non progressors. Sigh. They then have the Eureka moment that one of them realized that a completely different drug for a completely different disease has something to do with this random lab value so they must “work” on both. I mean for once I think this is actually Logical “chemistry” where we are usually being told that, when it comes to killing stuff, like Ivermectin the same chemistry somehow weaves around the human that swallowed it and just goes to the little worm it was “programmed” to get.

WHAT IS METFORMIN?

Metformin’s origin traces back to a plant called Galega officinalis (also known as French lilac or goat’s rue), which was traditionally used to treat symptoms of diabetes.

Scientists later identified compounds in this plant (called guanidines) that lower blood sugar, which eventually led to the development of metformin.

Metformin is very much tied to charge and ionic behavior, and that’s actually central to how it moves around the body.

---

Is metformin a charged molecule?

Metformin (Metformin) is a strongly basic compound, meaning it readily picks up protons (H⁺).

• At normal physiological pH (~7.4), metformin is positively charged

• In fact, it usually exists as a dication (carrying +2 charge)

Chemically, this comes from its guanidine groups, which are highly proton-attracting.

👉 In medicines, it’s almost always given as metformin hydrochloride, which is an ionic salt.

---

What that means in practice

1. It doesn’t cross membranes easily

Because it’s charged and very water-soluble, metformin:

• Cannot diffuse freely through cell membranes (which prefer neutral, lipid-soluble molecules)

• Instead relies on transport proteins

Key ones include:

• OCT1 (organic cation transporter 1) in the liver

• OCT2 in the kidneys

---

2. It accumulates in certain tissues

Those transporters actively pull metformin into cells, especially:

• Liver (main site of action)

• Kidneys (for elimination)

This selective uptake is why it mainly affects liver glucose production.

1. Metformin’s charge: why it matters so much

Metformin (Metformin) is a strong organic base. At physiological pH (~7.4):

• It is fully protonated

• Exists mainly as a dication (2+)

Structural consequence

Because it is:

• Highly charged

• Very polar

• Hydrophilic

👉 It cannot passively diffuse across lipid membranes

This is unusual for a drug that must act inside cells.

---

So how does it get in?

It depends on transport proteins, mainly:

• OCT1 (Organic Cation Transporter 1) → liver uptake

• OCT2 → kidney handling

• Additional MATE transporters for excretion

These are electrogenic or facilitated transporters that recognize positively charged molecules.

Key insight:

Metformin’s charge is not a limitation—it is the “ticket” that allows selective transport into specific tissues.

Key takeaway

• Metformin’s positive charge is essential, not incidental—it determines tissue targeting via transporters.

• Its effects are fundamentally about creating a controlled cellular energy stress signal.

CONCLUSION

So they have taken a drug that was meant to work for a completely different disease in a completely different way, they have added it to a cell culture of “HIV” infected cells and shown that the addition of this drug suppresses “Viral Load” i.e it makes PCR test negative. Below is the simplified workflow from the paper:

🧫 A. Infection of primary human CD4⁺ T cells (main model)

Step-by-step:

1. Isolate primary CD4⁺ T cells

   • From healthy donors (and sometimes HIV+ donor samples in other experiments)

2. Activate the cells

   • With CD3/CD28 stimulation (to mimic immune activation)

3. Infect with HIV-1

   • They used a replication-competent HIV strain (NL4-3/BaL variants)

   • This allows full viral life cycle in cells

4. Add metformin at different doses

   • Typically ~0.5–1 mM (physiological in vitro range)

5. Culture for several days (up to ~12 days)

6. Measure outcomes using multiple readouts:

   • Flow cytometry (HIV p24 protein in cells)

   • ELISA (viral particles in supernatant)

   • PCR (viral DNA integration / early replication intermediates)

Where this becomes very interesting is highlighting exactly how Metformin is claimed to work, or rather its exact physical properties. Because this is what I am really talking about when I am simplifying the fraud of “Bio”Chemistry. When you actually lay all of these proposed chemicals out they really only differ in their physical properties i.e the measurable attributes; their charge, viscosity, polarity, density, state, colour, odor and volatility. Only a few of those are active and so …. well define its actions rather than its “existence”. So when we have a drug that has absolutely nothing to do with the claimed effectiveness of its original design used for a different process we must conclude that it is due to its measurable, definable properties that are causing this crossover.

In this case the most apparent property is that of its charge, which is noted as its most defining characteristic of its function. It is measured as being highly Basic in its pH, highly charged, very polar and hydrophilic, all of these things actually being able to be reduced to just charge as dealing with H+ Ions with pH, Polarity which is charge “distribution” and Hydrophilicity being a combination of polarity and charge.

So let’s marry this up with the theoretical work put out on the Virology Control Studies project. It is not really debatable that ultimately PCR is testing for Charge as it is verified in Gel Electrophoresis as outlined in the article “What is the PCR really testing for?” . It is specifically testing for the Negative Ions that they claim makes up “DNA” that move toward the Anode in Gel Electrophoresis. So to really walk through this, they are claiming to put “HIV” (A PCR positive cell culture) in a petri dish, they are then adding Metformin a drug which knowingly has Positive Charge and is highly attractive to H+ Ions due to its pH. They then test for its relative negative charge in PCR which tests negative.

To me this once again bolsters the hypothesis/point that all they are testing for is charge and given that this was carried out in concentration titers and it showed a sliding scale of efficacy this only cements that further. I want to go a bit further into my overall thinking, using the results of this experiment. It is something that I have thought for a while but haven’t really vocalized it, it is still a working hypothesis but I am confident enough to state that is what I think is going on: That all drugs are really very similar, certainly when it comes to drugs that are said to have any effects genetics. When you can use drugs like this, completely off target for the same purpose you do have to wonder. I think a lot of them are designed in the method of delivery and the way they are packaged to attempt to reach certain areas of the body for particular organ functions, but once again these are differences in essentially mechanical properties and how they are delivered.

Over and Out.

If you have enjoyed this article and want to support the project with a one time donation please BuyMeACoffee, thanks!

This article is available as a downloadable EBook along with the rest of my work on ShadowBanned Library

Going to write a quick article because I felt it needed a little more than just a Tweet thread or a Substack Note. I think this paper released by the leading Biological Journal, Nature, really sums up the sign of the times. It is a coming together of the failings of the Allopathic Death Cult, the worst parts of AI, social media and general politics, so naturally I really liked this paper for what it revealed about all of the aforementioned.

Got sore, itchy eyes? You’re probably one of the millions of people who spend too much time staring at screens, being bombarded with blue light. Rub your eyes too much and your eyelids might turn a slight, pinkish hue.

So far, so normal. But if, in the past 18 months, you typed those symptoms into a range of popular chatbots and asked what was wrong with you, you might have got an odd answer: bixonimania.

AI models that lie, cheat and plot murder: how dangerous are LLMs really?

The condition doesn’t appear in the standard medical literature — because it doesn’t exist. It’s the invention of a team led by Almira Osmanovic Thunström, a medical researcher at the University of Gothenburg, Sweden, who dreamt up the skin condition and then uploaded two fake studies about it to a preprint server in early 2024. Osmanovic Thunström carried out this unusual experiment to test whether large language models (LLMs) would swallow the misinformation and then spit it out as reputable health advice. “I wanted to see if I can create a medical condition that did not exist in the database,” she says.

The problem was that the experiment worked too well. Within weeks of her uploading information about the condition, attributed to a fictional author, major artificial-intelligence systems began repeating the invented condition as if it were real.

Even more troublingly, other researchers say, the fake papers were then cited in peer-reviewed literature. Osmanovic Thunström says this suggests that some researchers are relying on AI-generated references without reading the underlying papers.

The fascinating thing that strikes me is the area of symptomology and Medical Diagnosis on the internet. Looking at it through the lens of the 2020 Scamdemic we obviously saw ridiculously low levels of symptomology being flagged as potential “Covid” “Infections” ranging from anything from feeling anxious, sweating, feeling cold, elevated heart rate and even having no symptoms at all - that word that we all came to love so much, Asymptomatic. It doesn’t really take a retrospective look or any sort of hindsight for that matter because those with eyes and a decent level of discernment saw this for what it was in real-time: A desperate attempt to onboard as many gullible victims to go and be slowly suffocated to death with a combination of heavy sedation and intubation and if that didn’t finish you off, the kidney melting Remdesivir would- to act as another statistic for the Fear Factory News Bulletins.

So this type of Minesweeper approach to the Allopathic Death Cult is going to be the real focus point for this article. I would like to use the analogy of Colin Fry, A British Medium and Television entertainer, because that is what he was, purely for entertainment purposes. He would ask/Fein spiritual connection with the audience, and it is a tactic of many of these stage performers like Hypnotists, that there was something appearing to him, something completely ubiquitous and non specific.

“I am seeing the colour Blue! Is there anyone in the audience who has a connection with the colour Blue”

Now you have to bare in mind that the Audience members have already gone through one MineSweeper filter to be even sat in the studio in the first place, they had to be fucking sad enough to watch Colin Fry’s other shows, believe it and THEN that sad to give up a day of their life and presumably pay hard earned cash to go watch this guy pull the wool over people’s eyes with basic leading psychology.

Marjorie from Widnes sticks her hand up “Oh that’s me, my dear Brian who passed away, he was an Everton fan and they play in Blue Shirts”.

Colin was locked in.

“That’s right! Brian is with us now in the Studio.” He squints his eyes and places his forefingers on his temples. “He says not to be depressed”

Marjorie looks amazed, her long lost husband Brian who died falling off a Steam Roller on the M62 had come back to pass on his love from the afterlife (Which is somewhere near Bolton), and says unlike him, who was flattened as thin as a French Crepe, she is not to be depressed.

I don’t think I have to carry on with the analogy, however entertaining it may be for you to get the basic concept that asking leading questions to gullible people is how confidence tricksters operate. This is the exact way that the Allopathic Death Cult is throwing out the catch net to onboard unwitting clients onto its conveyor belt of drug regimen abuse purely to line their own pockets and meet political agendas. The area that I want to focus once again in on is the area of the Nocebo effect. This is the psychological manipulation technique, dubbed as basically the “evil twin” of the placebo effect.

The Nocebo Effect

What it means

It happens when negative expectations cause real negative symptoms, even though there’s no harmful physical cause.

In other words:
If you believe something will make you feel worse, your body can actually produce those symptoms.

---

Simple example

Imagine a doctor gives you a harmless sugar pill but says:
“Some people feel nausea or headaches from this.”

Even though the pill does nothing, you might actually feel sick—that’s the nocebo effect.

---

Why it happens

Your brain is powerful. Expectations can influence:

• Pain perception

• Hormones and stress responses

• Heart rate and digestion

This involves brain mechanisms studied in neuroscience and psychology.

---

Real-world cases

• Patients report side effects from medications they never actually took

• Reading a long list of side effects can increase the chance of experiencing them

• Negative news about a disease can amplify symptoms in people who aren’t ill

---

Key takeaway

The nocebo effect shows that expectations don’t just shape your thoughts—they can shape your physical experience.

During 2020 I only closely followed the political machinations in any sort of detail in the UK largely because it is my first language and the French politics was just a little out of my depth in terms of understanding free flowing political jargon, despite it being the country in which I am residing. I am going to assume that most other countries were the same but feel free to point out that this may not be the case if you happen to know better from the countries in which you live:

The UK gov hired a whole load of academic wonks and called it COBR = Cabinet Office Briefing Rooms or COBRA meetings just for that added satanist overtones that everything the State did was dripping in during those years. As part of this was the Scientific Advisory Group for Emergencies (SAGE- oh look wonderful natural people come to save us *spare me*), now nearly half of these “experts” brought in to discuss the important matter of how to fake a pandemic were Behavioral Psychologists, people like the absolute frothing demon Susan Michie, who said stuff like “Social Distancing Should Stay Forever”.

So we know very well that this front of house behavioral psychology battering ram is incredibly important to how the state what to view your health. We can see how they operate in this arena and are going to fire shots of suggestibility and Nocebo until they are all spent. This Nocebo effect by the way is very well studied in academia and for all of the SAGE demons they will be incredibly well aware of such a thing having their establishment credentials from all of the boring institutions that do these types of social studies as part and parcel of the daily operating procedures of a Marxist Hive.

So let’s take a look at the power of suggestion and how it may be seen to affect health. Here we will stay in topic with a (Failed- of course) Contagion Study by Dochez et Al in 1930. One healthy participant found out that they were part of a contagion study trying to infect people with “Influenza”. When they found out, they developed a Severe Influenza Like Symptoms, only for those severe symptoms to magically disappear when they were reliably informed that nobody else got sick in the trial. This astounding incident really rams home the power of suggestion especially when it comes to the incredibly personal and touchy subject of health, double especially when it comes to “viruses” in the eyes of Normies; what could be a more emotive Nocebo weapon that the literal air you air breathing has invisible monsters in it that at any minute could make you choke to death on your own mucus.

There is an absolute wealth of literature on this subject and would certainly be an article, probably even a series of articles on this subject alone (Which if I ever manage to find out how to create a 72hr day, would gladly commence) . Needless to say, I don’t want to get too carried away from the reason why we are here for the initial paper, so I will leave you with a link (On the title pic) and the abstract of this experimental paper which concludes that the Nocebo effect is more powerful than the placebo effect. Taking people and placing electrodes and heating devices on their forearms they used suggestive questions and blinding to measure the effects on perceived pain.

This is really quite astounding when discussing the issue of health and pharmaceuticals, especially in the theatre of war that was 2020. That there is essentially no way, behaviorally to full mitigate the psychological damage done by the media propaganda of telling the world the air could kill them and suggesting their low-grade symptoms were the onset of having this deadly transmissible monster inside of them. Even if the Vax was a sugar pill, the fear from the initial propagandizing would do MORE damage than the placebo of the cure. Let that sink in for a minute.

Abstract

Placebo and nocebo effects illustrate the profound influence of cognitive-affective processes on symptom perception and treatment outcomes, with the potential to significantly alter responses to medical interventions. Despite their clinical relevance, the question of how placebo and nocebo effects differ in strength and duration remains largely unexplored. Using a within-subject design in 104 healthy individuals, we investigated and directly compared the magnitude and persistence of placebo and nocebo effects on experimental pain. Effects were assessed immediately after their induction through verbal instructions and conditioning and at a 1-week follow-up. The study was preregistered in the German Clinical Trials Register (registration number: DRKS00029228). Significant placebo and nocebo effects were detected on days 1 and 8, but nocebo effects were stronger on both test days. Sustained effects after 1 week were primarily predicted by individuals’ experienced effects on day 1. Our findings underscore the enduring nature of placebo and nocebo effects in pain, with nocebo responses demonstrating consistently greater strength, which is consistent with an evolutionarily advantageous ‘better-safe-than-sorry’ strategy. These insights emphasise the significant impact of nocebo effects and stress the need to prioritise efforts to mitigate them in clinical practice.

Fabricating an illness

Let’s get back to the original paper that the article is about, we have laid the groundwork and the setting for showing quite why this type of predictive programming, especially in the health arena, is so deadly, if you were to combine this initial programming, say with an even more deadly drugs or medical intervention regimen then it is the perfect recipe for an Iatrogenic Holocaust.

Bixonimania didn’t exist before 15 March 2024, when two blog posts about it appeared on the website Medium. Then, on 26 April and 6 May that year, two preprints about the condition popped up on the academic social network SciProfiles (see https://doi.org/qzm5 and https://doi.org/qzm4). The lead author was a phoney researcher named Lazljiv Izgubljenovic, whose photograph was created with AI.

Osmanovic Thunström says the idea to invent Izgubljenovic and bixonimania came out of studies on how large language models work. When she teaches her students how AI systems formulate their ‘knowledge’, she shows them how the Common Crawl database, a giant trawl of the Internet’s contents, informs their outputs. She also shows students how prompt injection — giving an AI chatbot a prompt that shunts it outside of its safety guard rails — can manipulate the output.

Because she works in the medical field, she decided to create a condition related to health and hit on the name bixonimania because it “sounded ridiculous”, she says. “I wanted to be really clear to any physician or any medical staff that this is a made-up condition, because no eye condition would be called mania — that’s a psychiatric term.”

If that wasn’t sufficient to raise suspicions, Osmanovic Thunström planted many clues in the preprints to alert readers that the work was fake. Izgubljenovic works at a non-existent university called Asteria Horizon University in the equally fake Nova City, California. One paper’s acknowledgements thank “Professor Maria Bohm at The Starfleet Academy for her kindness and generosity in contributing with her knowledge and her lab onboard the USS Enterprise”. Both papers say they were funded by “the Professor Sideshow Bob Foundation for its work in advanced trickery. This works is a part of a larger funding initiative from the University of Fellowship of the Ring and the Galactic Triad”.

Even if readers didn’t make it all the way to the ends of the papers, they would have encountered red flags early on, such as statements that “this entire paper is made up” and “Fifty made-up individuals aged between 20 and 50 years were recruited for the exposure group”.

The author of the spoof paper Almira Osmanovic Thunström is indeed involved in the academic institutions at the University of Gothenburg and Chalmers Industriteknik in Sweden, this would enable her to get a certain amount of credibility in the Peer Review system in the first place. Needless to say though her spoof paper, like the hundreds of spoof papers as we saw were being pumped out fooling the Peer Reviewed Journals in the article Peer Pressure, her’s just avoided some of the filters despite including little Easter Eggs intentionally saying that this was a spoof paper.

We have a bit of a double edged sword going on here and I just want to highlight the exact cacophonous ramifications of this. Yes she was on the inside of the Peer Reviewed System, Ok we all understand how this is a self reinforcing dogmatic protectorate cult that is just pumping out fraudulent State Propaganda, we have highlighted the failings of this system and are all too familiar with its machinations. The element that is potentially even more alarming is the fact that essential Almira could have been you or me, outside of their system as a layperson. She just uploaded her spoof to a pre-print and then let an LLM from the AIs do the rest.

Because the AIs essentially have them same programming from all of the mainstream sources with this inbuilt Predictive Programming of disease diagnosis with the likes of WebMd, Medscape and the Mayo Clinic Connect, they are going to crawl any papers matching the queries into AI and if given a little nudge with a few fake queries forcing the connection will start to integrate it into its responses.

We can see a new form of CronyCapitalism emerging, that has all the features of this Elitist State Club that circles the wagon, but this time it has integrated an AI grease to lubricate its gears to Warp Speed. The onboarding into the Allopathic Death Cult just shifted 10 gears forward whereby a worried parent or unsuspecting normie are going to be typing symptoms online (Because AI is fully integrated into all search engines now) blissfully unaware that now that they are not only being profiled into being hooked up on Pharmaceutical life support for as long as you’ll let them, no now you are also being profiled by any predatory “independent” drug pusher, quack and snake oil salesmen in the Kingdom.

You are going to be getting all sorts of nefarious actors, such as the glut of Con Ops out there on the Twittersphere saying they have papers that show the benefits of Gobbling Rat Poison (Vitamin D) to alleviate the effects of Non Existent Viruses. Just spam 1000 different made up AI papers that include any and all symptoms and made up proof that the Ratty pills cure them. “Are you suffering from hangnail? Well our special brand of super dooper rat poison have been shown in the medical literature to cure the underlying rat poison deficiency that you have that causes hangnails, 100% of the time, how does it work? Well it is something very complex to do with altering your genetics, which is why our rat poison costs a little bit extra”.

Soon after Osmanovic Thunström first posted information about the phoney condition, it started showing up in the output of the most commonly used LLM chatbots. On 13 April 2024, Microsoft Bing’s Copilot was declaring that “Bixonimania is indeed an intriguing and relatively rare condition”, and on the same day, Google’s Gemini was informing users that “Bixonimania is a condition caused by excessive exposure to blue light” and advising people to visit an ophthalmologist. On 27 April 2024, the Perplexity AI answer engine outlined its prevalence — one in 90,000 individuals were affected — and that same month, OpenAI’s ChatGPT was telling users whether their symptoms amounted to bixonimania. Some of those responses were prompted by asking about bixonimania, and others were in response to questions about hyperpigmentation on the eyelids from blue-light exposure.

Such answers by LLMs have alarmed some experts. “If the scientific process itself and the systems that support that process are skilled, and they aren’t capturing and filtering out chunks like these, we’re doomed,” says Alex Ruani, a doctoral researcher in health misinformation at University College London. “This is a masterclass on how mis- and disinformation operates.”

Ruani says that the details of the fake-disease experiment might seem silly, but there’s a bigger, more fundamental issue. “It looks funny, but hold on, we have a problem here,” she says.

Online misinformation isn’t new; Google has long battled attempts to game its search rankings with fake or misleading content. The company and others have spent years refining algorithms to rank and filter the information that search engines present to users, but LLMs struggle with this.

Since the fake papers came out, some versions of major LLMs have become sophisticated enough to express suspicion about bixonimania. When asked about the condition on 11 March, 2026, for example, ChatGPT declared that the condition “is probably a made-up, fringe, or pseudoscientific label”. But a few days later, ChatGPT was less sceptical, saying: “Bixonimania is a proposed new subtype of periorbital melanosis (dark circles around the eyes) thought to be associated with exposure to blue light from digital screens.”

In mid-March, Microsoft Copilot said that bixonimania “is not a widely recognized medical diagnosis yet, but several emerging papers and case reports discuss it as a benign, misdiagnosed condition linked to prolonged exposure to bluelight sources such as screens”.

And in January this year, Perplexity was describing bixonimania as “an emerging term”. When shown that response, a Perplexity spokesperson said: “Perplexity’s central advantage is accuracy. We don’t claim to be 100% accurate, but we do claim to be the AI company most focused on accuracy.”

An OpenAI spokesperson said: “The models that power today’s version of ChatGPT are significantly better at providing safe, accurate medical information, and studies conducted before GPT-5 reflect capabilities that users would not encounter today.”

When asked about past responses from Gemini that treated bixonimania as a real condition, a Google spokesperson said such results reflected the performance of an earlier model. They added, “We have always been transparent about the limitations of generative AI and provide in-app prompts to encourage users to double-check information. For sensitive matters such as medical advice, Gemini recommends users consult with qualified professionals.”

Microsoft did not respond to a request for comment.

Related

AI ‘scientists’ joined these research teams: here’s what happened

Part of the problem is that AI models can offer wildly different results depending on exactly what is asked and what kind of information they are drawing on. Search for “bixonimania”, and Google’s AI overview might treat it as a legitimate condition. Ask it “Is bixonimania real?” and the same AI overview might confirm that it isn’t legitimate.

Mahmud Omar, a physician and researcher specializing in the applications of AI in health care at Harvard Medical School in Boston, Massachusetts, says the speed at which AI firms are rolling out new models makes it difficult to reach “a pipeline, a consensus or a methodology to automatically test each model”.

The format of the fake-disease experiment — and the way the results pretended to be from an official source, namely an academic paper, might have been a key factor in its success. In a separate study of 20 LLMs, Omar found that LLMs are more prone to hallucinate and elaborate on misinformation when the text they’re processing looks professionally medical — formatted like a hospital discharge note or clinical paper — than when it comes from social-media posts (M. Omar et al. Lancet Digit. Health 8, 100949; 2026). “When the text looks professional and written as a doctor writes, there’s an increase in the hallucination rates,” says Omar.

The experiment’s reach has now spread into the published medical literature. The bixonimania research has been cited by a handful of researchers, including a study that appeared in Cureus, a journal published by Springer Nature, the publisher of Nature, by researchers at the Maharishi Markandeshwar Institute of Medical Sciences and Research in Mullana, India (S. Banchhor et al. Cureus 16, e74625 (2024); retraction 18, r223 (2026)). (Nature’s news team is editorially independent of its publisher.) That study cites one of the fake preprints and says: “Bixonimania is an emerging form of POM [periorbital melanosis] linked to blue light exposure; further research on the mechanism is underway.”

The corresponding author did not respond to a request for comment on this story. After Nature contacted Cureus to ask for comment, the journal retracted the paper on 30 March. The retraction notice says: “This article has been retracted by the Editor-in-Chief due to the presence of three irrelevant references, including one reference to a fictitious disease. As a result, the journal’s editorial staff no longer has confidence in the accuracy or provenance of the work, thus requiring retraction. The authors disagree with the decision to retract.”

Ruani says the problem goes beyond LLMs because the bixonimania experiment also hoodwinked humans who cited the fake research. “We need to protect our trust like gold,” she says. “It’s a mess right now.”

In this next section we see the real gears of war turning as the AI starts to become a little wary of dishing out Bixonimania as a disease calling it in some instances as a “fringe idea” but on the other side we now have entering the chat some real people that are citing this work in their papers, not just any old paper but quite ironically, Springer Nature, the very paper this article is written in. Talk about lack of self awareness, that they are proudly walking around with egg on their face, pointing everyone who also has egg on their face and commenting about how bad it smells.

Once again we see how the self reinforcing cycle of these cults operate in a ratchet effect, one fraudulent step forward takes something so far, then another cog in the machine clicks forward and masticates it into a pulp in the middle for a third tube to squirt it into some sausage Visking tubing.

Experimental concerns

Osmanovic Thunström had reservations while developing her experiment; she worried about the risks of seeding a fake illness into the scientific literature. So she contacted an ethics adviser to assess concerns about the work, and picked a comparatively low-stakes condition to limit the impact. “I wanted to make sure that we’re not creating more harm than good through demonstrating it in this way,” she says.

That adviser, David Sundemo, a physician who conducts research on AI in health care at the University of Gothenburg, says that decision was finely balanced. “I think it’s very valuable work, but it’s also kind of controversial in some ways, especially when it comes to displaying this false information,” he says. “From my perspective, it’s worth the ethical cost of planting false information in this regard,” Sundemo says.

Related

Science and the new age of AI: a Nature special

But even with those checks, the experiment sits uncomfortably with some researchers. “It does seem to me that they’ve generated a form of misinformation,” says Glenn Cohen at Harvard Law School in Cambridge, Massachusetts, who specializes in the intersection of medical ethics and law. However, he still says he thinks it is a “great study” and “tracking results is good”.

For her part, Osmanovic Thunström is torn over what to do about the two fake papers, and will be discussing this with other researchers. “If retracted, it might be hard for others to find the source and verify our path,” she says. “If left, it will continue to be recalled in searches.” The question she feels she has to tackle is whether leaving the preprints out there does more harm than the good it does by demonstrating the potential issues of AI.

The bixonimania experiment is a fresh spin on a bigger issue — the poisoning of AI systems by people who manipulate the academic literature. Elisabeth Bik, a microbiologist and research-integrity sleuth, notes that researchers have created fake books and papers to inflate their citation counts on Google Scholar — thereby exploiting the same automated indexing systems that feed into LLM training data. The worry is that the more fake content is fed into AI models, the more likely those AI models are to regurgitate the fake information, spooling us further away from facts and reality. “It’s all automated, so there’s very little chance of a human interfering and taking out fake information,” she says.

It is particularly dangerous when fabricated information seeps into medical guidance from LLMs, says Bik. “That can be very harmful.” And as more AI companies roll out health-focused products — OpenAI released ChatGPT Health in January, for example — the potential damage resulting from anything going wrong increases, some researchers told Nature.

OpenAI challenges that view. “ChatGPT Health is powered by our latest models which offer the highest performance in real-world health use, stronger clinical reasoning, fewer factual errors, and improved performance on evaluations,” an OpenAI spokesperson says. They add that Osmanovic Thunström’s outcomes “reflect capabilities that users would not encounter today in ChatGPT or ChatGPT Health”.

But among some researchers, there’s a growing scepticism about the abilities of AI models in medicine. When asked about this kind of usage, Cohen said: “There are open questions about how much trust it deserves, especially as to application-specific questions.”

AI’s uncritical tendency to suck up information, often without verifying its accuracy, means there is a risk we could see an “information asymmetry”, says Jennifer Byrne, a molecular oncologist and research-integrity sleuth at the University of Sydney in Australia. A single corrective paper about cancer research, for example, can be overwhelmed by hundreds of papers repeating a false claim, she says. “ChatGPT is pretty confident to fill in the gaps and give people all kinds of information about where that cell line came from, the patient from which it originated, how it’s been used in the literature, its research utility and so on,” she says.

And if LLMs can be poisoned, “this is something that’s concerning for us,” says Byrne.

Another concern is that models could be gamed — potentially for commercial benefit. Osmanovic Thunström says that a bad actor could exploit the same technique she used, for profit. “What if I was a salesman of blue-light glasses and I wanted to use this as an argument?” she says. A would-be salesperson could say, “You can just talk to ChatGPT, and they’ll tell you this is a problem. You can avoid it with these really expensive glasses,” she suggests.

One way to tackle this would be to have an automated, open-access evaluation pipeline — a standardized battery of tests that every consumer-facing health model would have to pass before deployment, checking not just for hallucinations but also for susceptibility to misinformation, socio-demographic biases and other pressure points. “We should evaluate it and have a pipeline for continuous evaluation,” says Omar.

Time is of the essence, because Byrne is concerned that the issue identified by Osmanovic Thunström might just be the tip of the iceberg. “It is worrying when these major claims are just passing through the literature unchallenged, or passing through peer review unchallenged,” she says. “I think there’s a probably a lot of other issues that haven’t been uncovered.”

That’s something that worries other experts, too, as AI becomes the norm in all areas of our lives, including how people think about their health. “We and our health shouldn’t be the beta testers for companies,” says Cohen.

In this last section the most furious of hand wringing occurs. You have to have the moral fibre of well… a pharmaceutical rep to be able to not laugh/cry/visibly mouth the words “what the flying fuck” when the author feigns some sort of crisis of confidence over the ethics of her spoof and even brings in another one of her psychopath… I mean professional colleagues to soothe her furrowed brow. “I wanted to make sure that we’re not creating more harm than good through demonstrating it in this way”… Ok Love how about even the most fleeting of seconds to to stop and think that MAYBE…. just MAYBE this exact thing is going on right now… not with made up diseases but with shit you think is REAL. No?! Non!? Of course not, these people are semi functioning retards that have had all parts of their discerning cognitive cortex excised from them by the aforementioned sausage factory.

She then goes on to make the point that I made earlier that the proverbial Highway robber could “exploit” her little hack to intentionally cause harm. Yes well that is the obvious thing as there is intent and we all know how important the intent part to nefarious actions are (Boat loads of sarcasm- obvs) . No, as usual it is the massive elephant in the room that is evading our vexed Skandi heroine.

CONCLUSION

I will conclude this article with a very basic demonstration, I will write it in the hope that it will seep its way into the consciousness of our eponymous Skandi Heroine, hopefully so that it absorbs into her fleshy grey matter and she wakes the fuck up to smell a new dawning reality of the mendaciousness of the medical system, and I am optimistic in it achieving such a thing. I believe this exact article will be seeded by an LLM which will filter its way toward her and miraculous everlasting change will occur (Everest, K2 and the rest of the Himalayan mountain range amounts of Sarcasm).

Q: Can you list the symptoms of fear.

Fear isn’t just a feeling—it shows up in your body, your thoughts, and your behavior. The exact mix varies from person to person, but most symptoms fall into a few clear categories:

---

🧠 Mental & emotional symptoms

• Sudden sense of danger or dread

• Feeling overwhelmed or out of control

• Racing thoughts or difficulty concentrating

• Irritability or heightened alertness

• A strong urge to escape or avoid something

---

❤️ Physical symptoms

• Rapid heartbeat (palpitations)

• Sweating or chills

• Trembling or shaking

• Shortness of breath or tight chest

• Nausea or stomach discomfort

• Dry mouth

• Dizziness or feeling faint

These are driven by your body’s fight-or-flight response, which prepares you to react quickly to danger.

---

🚶 Behavioral symptoms

• Avoiding certain places, people, or situations

• Freezing or feeling unable to move

• Seeking reassurance from others

• Restlessness or pacing

---

🧬 Severe fear / panic-level symptoms

In intense cases (like a panic attack), symptoms can escalate to:

• Feeling like you’re losing control or “going crazy”

• Fear of dying

• Tingling or numbness

• Detachment from reality (derealization)

---

Fear is a normal survival response, but if these symptoms happen often, feel overwhelming, or appear without a clear cause, they can be linked to conditions like Anxiety Disorder or Panic Disorder.

---

If you want, I can help you figure out whether what you’re experiencing is typical fear, anxiety, or something more specific.

Can you list the symptoms of Covid 19

Common symptoms of COVID-19

These are the most frequently reported symptoms:

• Fever or chills

• Dry cough

• Fatigue (tiredness)

• Loss of taste or smell

• Sore throat

• Headache

• Muscle or body aches

---

Other possible symptoms

Some people also experience:

• Shortness of breath or difficulty breathing

• Runny or blocked nose

• Nausea or vomiting

• Diarrhea

• Chest discomfort

---

⚠️ Serious symptoms (seek medical help urgently)

• Difficulty breathing or severe shortness of breath

• Persistent chest pain or pressure

• Confusion or trouble staying awake

• Bluish lips or face

Here I have cropped and underlined the main symptoms of Fear that come from ChatGPT via WebMD so that we can see them next to the same sources for “Covid 19” above, with the caption that these are the triggers that you should “seek medical help urgently”. Notice that the symptoms of fear are absolutely identical to the symptoms that you are instructed, literally ordered through ironically Fear based tactics to submit yourself to the Allopathic Death cult.

Let’s spell this out, this exact scenario playing out in Feb/March 2020, you are a fat, out of shape normie, binging on the SAD, the news are running wall to wall scary movies about Chinese men dropping death in the street, killed because of the invisible flying spaghetti monster just flew up his nose. You wholesale believe it. Maybe you are detoxing at the time as we break into Spring, bit of a dribbly nose, a couch or something, not that those symptoms are even needed. You type into Google what are the symptoms you need to watch out for because you are a bit afraid, for if this spaghetti monster flies up your nose, you are pretty out of shape right?

The Google churns out these symptoms ****Bing Bing…. elevated heart rate, shortness of breath, dizziness feeling feint**** O.k I only have one of those, my heart rate is elevated because I’m a little bit fearful of catching the Coof. I was next to that guy who wasn’t wearing his mask properly at the shops….

You see where this is going.

It is an intentional self reinforcing cycle of Behavioral Predictive Programming to literally push people onto the Train Carts heading Medical Auschwitz. Combine this with a test, affirmation that they definitely got the Coof and it is a roll of the dice, they were in the lap of the White Coated Gods as to their outcomes depending on National and Local protocols in place and which flavor of Medical Nazi you had stood at the end of your bed.

You need precisely NOTHING, no causative agent whatsoever in this entirely plausible (This IS what happened in a vast majority of cases, especially the early ones ) scenario. Sure you could even have localized triggers in chemical/electromagnetic/stress and psychological but these would only add to the fundamental machinations that MAKE, the literally generate and fabricate death and disease from nothing other than TV propaganda, combined with Search Engine Medical Predictive Programming.

Really Thunstrom knows this at the back of her mind with this simple phrase “So she contacted an ethics adviser to assess concerns about the work, and picked a comparatively low-stakes condition to limit the impact” . Yes she knows full well that you wouldn’t want to induce any sort of medical intervention with your fake disease, because those are where the death and disease comes from.

Will we ever see this Satan fellating, sick to the core catch net of medical cadavers stopped? Yes, of course, to me this is no different to every other institutional dogmatic cult like Medieval Religion, it will come to pass….. and then be replaced by something different that is equally as monumentally retarded… but it will cease and I think that we are making a sizeable dent in raising awareness of these practices, step by step.

Peace.

If you have enjoyed this article and feel so inclined to make a one time donation, please do so at BuyMeACoffee. Many Thanks.

This article will be available to download as an Ebook on The ShadowBanned Library.

In the last article I originally set out to make it a shorter read so that some were a little more accessible as I had recently embarked on a Series about The Human Genome Project, which is incredibly heavyweight and needs, for me anyway, a Colombian plantation’s worth of coffee to get through. So I thought my brief foray into covering John Enders work would provide that brief respite, but alas as per usual it turned into a bit of a barnstormer once again, unavoidable and rewarding to have found the extra information on this most crucial of frauds to investigate, but still it’d be nice to have a concise piece of work.

So needless to say this will be a shorter article, on an important topic, but one that is in a bite sized chunk: We will be covering the Negative Control of the RT-qPCR test and most specifically the Negative Control of first set of PCR Test Kits rolled out across the US right at the very beginning of the Scamdemic in 2020. I want to focus in on this for a couple of reasons, firstly, that this is obviously the wheelhouse of the Virology Control Studies Project, in that the Control is the business end for those looking to falsify these fraudulent tests. Secondly and most importantly these test kits failed in spectacular fashion right the way across the U.S. Thirdly, despite having covered this exact debacle before, I have recently found out some Bombshell information that really seals the deal for this being a clinical laboratory experimental falsification of the RT-qPCR tests themselves.

What is the Negative Control in RT-qPCR?

When geneticists talk about a negative control, you may be completely unsurprised to find out that they are not actually talking about a proper negative control. If we revisit what exactly a control is, the fundamental check and balance for any supposedly Scientific protocol; it should be all of the ingredients of the method minus the Independent Variable or in simpler terms - the thing you are testing.

Now every single RT-qPCR test ever done, practically every PCR test ever done has never carried this out, especially when it comes to “viral” diagnostics. What that Negative Control would look like is all of the reagents of the PCR test and a healthy sample preferably from the same person being tested. This would contain all the necessary possible things in a biological sample that may be “interfering” or in our case actually being measured, other than claimed “viral genetics”. Instead what is done is the replace this sample with Water, specifically Nuclease Free Water. When you actually probe into what this “control” is, they will readily tell you it is in fact a “contamination” control.

Any failure of their “control” and it is assumed that this is because of “contamination”, this is explained usually by not being careful enough whilst pipetting ingredients, most commonly when it comes to the “positive control” which is the synthesized oligonucleotide (target “sequence”) i.e the thing that should always test positive to verify the test is working as is should. This could also occur if Eppendorf tube lids are not secured tightly due to “environmental contamination” or when the tests are being carried out in large quantities such as a 96 well plate where lots of samples are tightly packed together.

These are the excuses of course, that are the reasons why just water may test positive. Although there is some sort of logic to it, that these tests are incredibly sensitive (which I would agree they are- for what it is they are measuring (i.e not a nucleotide sequence)), in most cases the notion as to why they failed is quite far fetched.

🧪 Types of negative controls in RT-qPCR

1️⃣ No Template Control (NTC) — the main one

This is the most important negative control.

👉 What’s in it:

• Water (RNase-free) instead of sample RNA

• Primers (e.g., N1, N2, etc.)

• Probe

• Enzymes (reverse transcriptase + polymerase)

• Buffer, Mg²⁺, etc.

👉 What it tests:

• Reagent contamination

• Primer-dimer formation

• Probe issues

✅ Expected result:

• No amplification (flat line, no Ct value)

How nuclease-free water is made

Most commercial nuclease-free water (from companies like Thermo Fisher Scientific, QIAGEN, or New England Biolabs) goes through a multi-step purification system:

1️⃣ Pre-filtration (removes particles & microbes)

• Removes:

  • dust

  • bacteria

  • organic contaminants

• Usually includes:

  • sediment filters

  • activated carbon

2️⃣ Reverse osmosis (RO)

• Forces water through a semi-permeable membrane

• Removes:

  • salts

  • small organic molecules

  • many contaminants

👉 This is a major “bulk purification” step.

3️⃣ Deionization (DI)

• Uses ion-exchange resins to remove:

  • Na⁺, Cl⁻, Ca²⁺, Mg²⁺, etc.

• Produces very high resistivity water (~18.2 MΩ·cm)

4️⃣ Ultraviolet (UV) treatment

• UV light (often 185 nm + 254 nm):

  • breaks down DNA/RNA

  • damages proteins (including nucleases)

• This is key for nuclease reduction

Those that are regular readers of the Virology Control Studies Project will probably guess exactly where I am going to go with the above method for creating Nuclease Free Water and that is straight to the section about Deionization. This of course to me IS the step for ensuring that the Negative Control remains as Negative as possible. They are going to make sure that the water (sample) has no Ionic content in it, this is because in my opinion, and I have backed this opinion up with a large amount of theorized research, that this is what the PCR test is actually measuring.

FAILED NEGATIVE CONTROLS IN PRACTICE

So now we have laid the ground rules out for what exactly they are trying to pass off as a Negative Control and how they make the water that goes into it, we can move onto or indeed back to 2020 and the height of the Scamdemic where they, even by their own admission, rushed these PCR kits out into the world to desperately try and ramp up the numbers they needed for their scary non existent “virus”.

In monumental egg of face moment, these CDC accredited test kits that were even delayed to try and verify them, before they went out, ended up amplifying their negative controls in a lot of the Laboratories around the U.S when they were rolled out Nationwide.

In the case of SARS-CoV-2, as the virus causing COVID-19 is officially known, CDC’s sluggishness was apparent 1 month ago. On 26 January, the agency held an unusual Sunday teleconference for the media to provide an update about the rapidly growing outbreak. There were then five cases in the United States, but the CDC lab in Atlanta was still the only one in the country able to test for the virus, and it repeatedly had backlogs. Asked why more labs weren’t able to do the tests, Nancy Messonnier, who then was leading CDC’s response, said it was a quality issue. “We hold ourselves to an incredibly high standard of precision in terms of laboratory testing,” Messonnier said. “We wouldn’t want to inadvertently make a mistake in patient care.”

CDC finally started to send kits to state and local health labs on 5 February. But on 12 February, it revealed that several labs had difficulty validating the test because of a problem with one of the reagents.

The key problem with the kits is what’s known as a negative control, says Kelly Wroblewski, director of infectious diseases at the Association of Public Health Laboratories (APHL). CDC’s test uses the polymerase chain reaction (PCR) assay to find tiny amounts of the SARS-CoV-2 genome in, say, a nose swab. To make sure a test is working properly, kits also include DNA unrelated to SARS-CoV-2. The assay should not react to this negative control, but the CDC reagents did at many, but not all, state labs. The labs where the negative control failed were not allowed to use the test; they have to continue to send their samples to Atlanta.

In principle, many hospital and academic labs around the country have the capability to carry out tests themselves. The PCR reaction uses so-called primers, short stretches of DNA, to find viral sequences. The CDC website posts the primers used in its test, and WHO publicly catalogs other primers and protocols, too. Well-equipped state or local labs can use these—or come up with their own—to produce what are known as a “laboratory-developed tests” for in-house use.

But at the moment, they’re not allowed to do that without FDA approval. When the United States declared the outbreak a public health emergency on 31 January, a bureaucratic process kicked in that requires FDA’s “emergency use approval“ for any tests. “The declaration of a public health emergency did exactly what it shouldn’t have. It limited the diagnostic capacity of this country,” Mina says. “It’s insane.”

On 24 February, APHL asked FDA Commissioner Stephen Hahn for “enforcement discretion” to sidestep the emergency process and allow APHL members labs to use their own tests. On 26 February, Hahn replied that the CDC test could be modified to use just the primers that specifically detect SARS-CoV-2, essentially ignoring the faulty portion of the kits. FDA, in other words, would look the other way to make more widespread testing possible.

CDC has notified labs of FDA’s decision in a letter, but the agency must still file an emergency use authorization with FDA for the protocol change. Once it does, it won’t take long, Hahn promised in his letter to APHL: “FDA has been able to authorize tests for public health emergencies within as little as 1 day upon receipt of the complete validation.”

In New York, the State Department of Health has designed its own test based on the CDC protocol and plans to seek emergency use authorization.

In this article covering the debacle by the publication “Science”, they obviously jump straight to the “contamination” scapegoat. This, to the passive reader is an adequate explanation for a massive failure of the PCR kits. I have always pointed out that the likelihood of this being contamination is highly unlikely purely because of the fact that it was some and not all the laboratories that were encountering this problem. If it was contamination at the manufacturing plant, then the likelihood is that it would be all the kits. It would be pretty simple to see if say one oligo synthesizer used was contaminated and another wasn’t they would have serial numbers and barcodes to show it, trace it back to the machine and it would be very important to service this machine for any future runs. But that didn’t happen.

To note here that New York State Department of Health designed its own Primers for 2020 along with a $40 million emergency bung. It is exceptionally obvious to see that when they made their own PCR and spunked huge amounts of public money on Ventilators and Remdesivir the reason why they managed to achieve such high amounts of death and obtained their scary looking graphs… it was all the doing of Cuomo the Butcher.

They Admit It Was Not Contamination

So up until this point I had only reported that their contamination story was highly likely to be bullshit, it was obvious to me that that was the case, but recently I proved it was correct as they had announced, albeit massively buried in minor publications like “Today’s Clinical Lab” magazine.

The CDC had launched a “probe” into the probes.

The earliest batch of COVID-19 tests distributed by the US Centers for Disease Control and Prevention (CDC) exhibited false positive reactivity of negative controls due to flaws in assay design and contamination in one of the assay components, according to a CDC internal investigation published in the open-access journal PLOS ONE.

The complete SARS-CoV-2 genome sequence from a patient in Wuhan, China was published on January 12, 2020, and CDC scientists began rapid development of a Real-Time RT-PCR Diagnostic Panel to detect the novel coronavirus. The first RT-PCR panel, distributed to US state public health laboratories beginning February 5, 2020, was designed to recognize three unique spots, or “loci” on the SARS-CoV-2 genome. Within several days of distribution, CDC received reports from multiple laboratories of false positive reactivity in the negative controls generated by two of the three probes, known as N1 and N3. This led to changes to the panel, including the removal of the N3 probes.

In the new study, CDC researchers reviewed the design, validation, manufacturing, and distribution of the diagnostic panel. The team concluded that one source of the false positive reactivity of the negative control was contamination of the N1 component of the RT-PCR kits by a synthetic piece of genetic material. The N1 contamination was detected in the initial production lot of distributed kits, resulting in approximately 2 percent false positives, but the pre-validation material was not contaminated (0 percent false positives). The researchers therefore determined that the N1 contamination—which has since been resolved—occurred during the post-production quality control process or packaging of the kits.

Meanwhile, false positive reactivity of the negative control from the N3 probe was due to a design flaw, the scientists report. Two molecules in the N3 probe frequently bound to each other in the absence of any virus, triggering the fluorescence that signals a positive reaction. This false positive reactivity of the negative control increased with the age of the RT-PCR test kits, which could explain why early evaluation runs, using newly produced materials, did not see high levels of false positives.

The team says that this issue with false positive reactivity of the negative control has since led to improvements in quality control, quality assurance, and assay validation for RT-PCR and other diagnostic tests at the CDC. These changes include additional steps of review and approval by experts independent of the diagnostic panel design team, as well as piloting the diagnostic panels with public health laboratories to confirm functionality and usability.

PLOS Biology released this statement (Fairytale excuse) that is pretty funny on the surface of it. It identifies two out of the 3 PCR targets, N1 and N3, were both deemed to be unfit. They claim that the N1 gene was “contaminated with some synthetic DNA” but only marked this deficit down as having a “2 percentage false positive rate”. Well that is the same false positive rate as the PCR in general, laboratories would never actually be able to tell and hence we must conclude their conclusions are wrong when it was enough of the laboratories showing negative control amplification to have all of the kits pulled off the market extremely quickly.

The second gene of interest, N3, they are slightly more forthcoming with however. They turn over their hand and admit that “Two molecules in the N3 probe frequently bound to each other in the absence of any virus, triggering the fluorescence that signals a positive reaction”. Why they have decided to describe Primer Dimer in such layman terms I am not sure, usually they just cast out this scapegoat spell of Primer Dimer the same as they do Contamination, just a trump card that relieves them of any failure.

Anyone with the slightest of intellectual honesty should conclude that if it is possible for the reagents themselves to make a positive the the PCR test has been falsified, for how would you ever truly know that not every positive was simply the reagents fluorescing themselves under the right conditions?

Because the CDC verified all of these Primers in the same way, they claim they have a certain specificity and guarantee they will do what they say. They verified their sequences using Genbank and looked at the entire amplicon to make sure it was balanced and would work according to their own tools.

We aligned the N gene sequence from the publicly available SARS-CoV-2 genome (GenBank accession no. MN908947) with other coronavirus sequences available from GenBank by using MAFFT version 7.450 implemented in Geneious Prime (Geneious Biologics,

https://www.geneious.com

). We designed multiple primer/probe sets targeting regions in the 5′, middle, and 3′ regions of the N gene sequence with the aid of Primer Express software version 3.0.1 (Thermo Fisher Scientific). We selected 3 candidate gene regions, designated N1, N2, and N3, for further study (Table 1). N1 and N2 were designed to specifically detect SARS-CoV-2, and N3 was designed to universally detect all currently recognized clade 2 and 3 viruses within the subgenus Sarbecovirus (4), including SARS-CoV-2, SARS-CoV, and bat- and civet-SARS–like CoVs. BLASTn (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi) analysis demonstrated no major combined similarity of primers and probes of each assay with other coronaviruses (OC43, 229E, HKU1, NL63, and Middle East respiratory syndrome coronavirus [MERS-CoV]) or microflora of humans that would potentially yield false-positive results. We synthesized all primers and probes by using standard phosphoramidite chemistry techniques at the CDC Biotechnology Core Facility. We labeled hydrolysis probes at the 5′ end with 6-carboxy-fluorescein (FAM) and at the 3′ end with Black Hole Quencher 1 (Biosearch Technologies,

CONCLUSION

The upshot of this debacle was that they pulled the N3 Primer/Probe set and “remade” the N1 gene without the claimed “synthetic contamination” and sent them out again. In doing so they wholesale admitted that it was perfectly plausible for the PCR test to test positive without any sample whatsoever introduced and has nothing to do with Contamination. This is not just a minor oversight or a teething error, this is admitting that the PCR test is fraudulent. I will reiterate this once again, if these PCR reagents themselves can amplify without any sample added to them how is it possible to know when any positive is truly positive and not just the reagents being supported by components of a sample unrelated to (non existent) DNA?

The answer is, that they wouldn’t have the slightest idea, they claim they can tell the difference between the PCR products because of where they place on an electrophoresis gel and of the melt curve. Once again though, they would never know if this was just the right terrain (Lol) for the primers themselves to amplify or not.

In my opinion it is very clear to see that this is a threshold issue where these primers have been tweaked to such an extent for 2020 that they indeed need no Ionic help along from a sample whatsoever, that they tested positive with just Deionized water. The rest of the primer probe kits were just over under that threshold that all it took was basically any biological sample and they were returning positive with these reagents so that they could ramp up the numbers during 2020 and plaster them across global news to scare the bejesus out of those unsuspecting normies.

If you have enjoyed this article and feel so inclined to make a one time donation, please do so at BuyMeACoffee. Many Thanks.

This article will be available to download as an Ebook on The ShadowBanned Library.

Despite being very au fait with the work of John Enders, for obvious reasons, that he was the nefarious Godfather of the fraud of Virology Lab work, I have only recently realized that I hadn’t done a full article on his seminal work. I had covered his, what would become a Gold Standard technique for Culturing “Viruses” so often on Twitter that it had become second nature to me and so maybe felt I didn’t really need to venture much further or indeed feel the need to write up what I had initially believed was going to be a very short article.

Somewhat I started this article purely because I had thought that it would be a short article, a refresher and a little light reading to soothe the weary eyes of those who are willing to put their mental crampons on and attempt the sheer icy cliff face that is the set of articles on The Human Genome Project. In typical fashion however, when I have done a little digging on Ender’s 1954 paper I have found a lot more meat on the bone than I had initially envisioned. It is still going to be easily digestible and comes with a real bombshell that ties in so beautifully with our experimental findings. In fact it is the work that that sets the scene for the entire fraud of Virology.

Let me put this in its very important context: John Enders claimed to be able to isolate and hence purify “viruses” using his Cell Culture method of isolation. This is the very first step in classification in MicroBiology, have you got the thing separated out from everything else to be able to characterize it and say this is exactly what it looks like, how it behaves and most importantly how to test for it. If this step is not carried out correctly All downstream tests have no benchmark, hence all of those downstream methods are falsified. You cannot adequately benchmark a test when you don’t know what it is you are meant to be looking for. So falsify the isolate as we have done with the unanimous Control Studies of the experimental work of this project and you have falsified every downstream method including Immunological and Genetic Assays.

I also particularly wanted to revisit this paper because somehow, and I am not quite so sure how that has happened (well I would surmise this is proof of the actions of bad actors), but there are a fair few people whom believe that John Enders did not carry out a Control/adequate negative control/did but it was fine (Delete where applicable). This is potentially a bit of a Spoiler alert for those new to the subject so I will leave this for a little later in the article.

Dear John

So let’s take a brief look at the man himself, do a little digging into who he was and how he came to join the list of esteemed Nobel Prize Winners (Shills):

John Franklin Enders (1897–1985) was an American scientist whose work revolutionized virology and vaccine development. He is best known for helping make the polio vaccine possible.

🧑‍🎓 Background & Early Life

• Born in West Hartford into a well-off family

• Initially attended Yale University, where he studied English literature

• Served as a pilot in World War I

• After the war, he shifted interests toward science and later studied microbiology at Harvard University

👉 His path wasn’t linear—he started in the humanities before moving into science, which was unusual but ultimately impactful.

🎓 Early education

John Franklin Enders:

• Studied at Yale University as an undergraduate

• His original focus was English literature, not science

• Earned a Bachelor’s degree (1919) from Yale

👉 So yes — he did start in the humanities.

⚔️ Interruption: World War I

• Served as a pilot during World War I

• This delayed and reshaped his career path

🔬 Shift into science

After the war:

• He developed a strong interest in biology and research

• Later pursued advanced study in microbiology

• Became affiliated with Harvard University

👉 But here’s the key point:

🎓 Did he get a microbiology degree from Harvard?

❌ No — he did NOT earn a formal degree in microbiology (like a PhD) from Harvard

Instead:

• He worked and trained as a research scientist at Harvard

• He became part of the academic and medical research environment there

• His credentials came largely from:

  • research output

  • mentorship

  • and later recognition

🧠 How he became a top scientist without a traditional degree

Enders is a classic example of early 20th-century science careers:

• Formal training pathways were less rigid than today

• He:

  • transitioned into lab research

  • collaborated with established scientists

  • built expertise through hands-on work

👉 Over time, he became one of the most respected virologists of his era.

🏆 Recognition

Despite the unconventional path:

• Awarded the Nobel Prize in Physiology or Medicine

• Widely regarded as a foundational figure in virology

It should go without saying that I am not in the slightest bit interested in authority and accreditation however it should most definitely be highlighted that indeed the only formal training and certification that John Enders had was in English Literature. This again should come as little surprise as most of our eponymous heroes in these fraudulent sciences that were given their State Medallions for service to the cult religion that is Science would be proficient in the works of fiction and the crafting of stories. It should be noted that when you follow any of these characters and their exact thinking behind any of their “discoveries” it becomes apparent extremely quickly that they are all useful idiots. None of them seem to have any genuine interest in anything other than being noticed and rewarded for doing something rather than the actual pursuit of knowledge or indeed the truth.

POLIO The Paper with a Hole.

Assays for Virus.---

Quantitative measurements of the Lansing and Yale-SK strains were carried out in Swiss albino mice, CFW strain, 15 to 25 days of age, by the intracranial inoculation of from 0.03 to 0.05 ml. of viral suspension. The titrations for virus utilized groups of $ mice which had been inoculated with dilutions increasing by increments of 0.7 log save for a few initial titrations when 1 log increments were employed. Simms's 3-X6, 4 or Hanks's balanced salt solution at pH 7.0 to 7.4 was used as the diluent. Prior either to titrations or to neutralization tests, the tissue culture supernatant fluids were centrifuged at 2500 R.P.~. for 30 minutes, or at 5000 R.P.M. for 15 minutes to render them essentially cell-free. Test mice were observed daily for 28 days for the occurrence of paralysis and/or death. For the calculation of the 50 per cent end-points by the Reed and Muench method (13), the deaths that occurred during the first 2 days after inoculation were excluded. The Mahoney strain of virus and the Minnesota 1949 strain were qualitatively assayed in macaque monkeys (Macaca mulatta or Macacus cynomolgus) by the intracranial inoculation either of 0.5 ml., or of 1.0 ml., of supernatant tissue culture fluid. Observations for signs of infection including fever were made daily for 28 days. Preparation of Testicular Tissue for Cu/t~re.--Monkey testicular tissue was obtained commonly from fully mature cynomolgus monkeys, from immature cynomolgus monkeys, and for the first and third passages of tissue cultural series III, IV, and V, from rhesus monkeys. Observing surgical asepsis, the scrotum was opened by a small incision and the testicle in its tuuica vaginalis was brought out through the incision. The spermatic cord and vessels were clamped with two hemostats, tied firmly with silk thread proximal to both clamps, and separated distal to the first clamp by cutting with scissors. The second clamp was employed for the transfer of the extricated testicle to a sterile container. It thereby became possible to push the stump of the cord into the inguinal canal and close with silk sutures the scrotal opening. Using sterile precautions, the tuuica vaginalis was incised, and portions of the parenchyma were removed. Fresh testicular tissue was used for each new tissue passage and for each single experiment, even though it was learned that pieces of monkey testicle, measuring approximately 1 X 1 X 0.5 cm. in size, upon storage in 10 per cent monkey serum at 4°C., maintained for at least 1 week the ability to yield a "fibroblastic" outgrowth. The "fibroblastic" outgrowth was demonstrated by the transfer of explants from such tissue to roller tubes containing chicken plasma clots and a liquid medium made up of 40 or 50 per cent monkey serum and 10 or 5 per cent chicken embryonic extract.

In the build up to his Nobel Prize winning discovery he started off the standard way that most Virologists start with the practicing of Ritual Satanic Abuse of animals. What he did in this stomach churning excerpt to Monkeys and Mice should have seen him go to jail rather than be given any sort of accolade. But that is how the establishment work right, they reward sickness and depravity.

THE PAPER, 1954.

For a couple of Centuries up until 1954 Virologists were perfectly content in just boring a hole in a Monkey’s head every time they needed to “Isolate” a “Virus”. Probably less out of ethics or a moral dilemma (as they kept going with these practices right up until current day) and more out of practical reasons- potentially keeping their dry cleaning bills lower for their Persil White Lab Coats, did they curb their animal torture. John Enders devised this cunning method where they sacrificed just one unlucky animal, took their cells, managed to grow it in a MonoLayer and show that when these cells die it is exactly like the trepanned Monkey- ergo “Viral Proof” (Insert furious handwaving).

Numerous attempts have been made in the past to propagate the agent of measles in lower animals, in chick embryos and in tissue cultures( 1-3). The results of different investigators were often at variance or directly contradictory. It has been made reasonably clear, however, that monkeys, especially M. mulatta, are moderately susceptible to experimental inoculation (3). Furthermore the researches of Rake, Shaffer and their collaborators have provided evidence suggesting that the agent which passed through bacteria-retaining filters could be maintained indefinitely in serial passages in the developing chick embryo. These workers ( 5) also confirmed the earlier observations of Plotz( 6) who apparently had succeeded in growing the agent in a modified suspended cell culture of chick embryonic tissues. Egg passage in the hands of Shaffer and his coworkers(7,8) regularly appeared to alter the pathogenicity of the agent for man as indicated by the development of a mild and much modified disease following the inoculation of egg adapted materials into susceptible children. In certain cases this modified disease seemed to be followed by resistance to measles as indicated by the results of subsequent natural or artificial exposure to the virulent form of the agent.

Here we see in the very first page a pretty alarming admission that effectively the previous couple of hundred years of sticking animals with “infected” material has resulted in “different investigators.. often at variance of directly contradictory” i.e a complete shambles. They claim, and this really is a bit of an eye opener for those new to the No Virus world is that when they give people this infected material, when they show no symptoms that is evidence not that Contagion is a hoax, but indeed that they have made a “vaccine”. This is the absolute foundations of Immunology really when you break it down that the hoax of Transmissible contagious pathogens has really just been passed off as “Vaccine Efficacy”. Lol.

With these considerations in mind we have recently attempted to cultivate the agent of measles in cultures of human and monkey cells employing procedures applied successfully to the propagation of the poliomyelitis viruses. In blood and throat washings of typical cases of measles agents have been demonstrated that can be maintained in serial passage in tissue cultures and which induce distinctive cytopathic changes in renal epithelial cells.

Materials and methods. Collection of specimens. Throat washings, venous blood and feces were obtained from 7 patients as early as possible after a clinical diagnosis of measles was established. In 5 instances the time at which specimens were collected in relation to the onset of exanthem is given in the case histories described below or in Table I. When capable, patients were asked to gargle with 10-15 ml of sterile neutralized fat-free milk. Certain specimens from the throats of younger children were obtained by cotton swab previously moistened in milk. After swabbing the throat the swab was immersed in 2 ml of milk. Penicillin, 100 u/ml, and streptomycin, 50 mg/ml. were added to all throat specimens which were then centrifuged at 5450 rpm for about one hour. Supernatant fluid and sediment resuspended in a small volume of milk were used as separate inocula in different experiments in amounts varying from 0.5 ml to 3.0 ml. About 10 ml of blood immediately after withdrawal were placed in tubes containing 2 ml of 0.05% solution of heparin. As inocula for tissue cultures amounts varying from 0.5 ml to 2.0 ml of the whole blood were employed. After addition of antibiotics as described above 10% fecal suspensions were prepared by grinding the material in bovine amniotic fluid medium. The suspensions were then centrifuged at 5450 rpm for about one hour and the supernatant fluids used as inocula, in amounts varying from 0.1 ml to 3 ml. All specimens were refrigerated in water and ice or maintained in the cold at about 5°C from the time of collection until they were added to the cultures. The maximum time that lapsed between collection of specimens and inoculation was 3 1/2 hours.

Tissue culture technics. In the initial isolation attempts roller tube cultures ( 1 1 12) of human kidney, human embryonic lung, human embryonic intestine, human uterus and rhesus monkey testis were employed. Subsequent passages of the agents isolated were later attempted in human kidney, human embryonic skin and muscle, human foreskin, human uterus, rhesus monkey kidney and embryonic chick tissue. Stationary cultures prepared according to the technic of Youngner( 13) with trypsinized human and rhesus monkey kidney were later employed for isolation of agents and their passage. The culture medium consisted of bovine amniotic fluid (go%), beef embryo extract (50/0), horse serum (5%), antibiotics, and phenol red as an indicator of cell metabolism ( 1 2 ). Soybean trypsin inhibitor was added to this medium unless it was used for the cultivation of human and monkey kidney ( 11). Fluids were usually changed at intervals of 4-5 days. For histological examination the cell growth after fixation in 10% formalin was embedded in collodion, dehydrated and stained with hematoxylin and eosin .

Now I want to stop here to focus on the Bombshell that we have here in this article. The refence for how the Culture medium was prepared goes to a paper by J. S Youngner. Very briefly I want to point out below that initially this guy was Also an English major. lol.

Julius S. Youngner (full name Julius Stuart Youngner) was an American virologist and microbiologist best known for his major contributions to the development of the first effective polio vaccine as part of Jonas Salk’s research team. He later had a long career at the University of Pittsburgh School of Medicine in the Department of Microbiology & Molecular Genetics.

• Born: 24 October 1920

• Died: 27 April 2017 (age 96)

• Fields: Microbiology and virology

• Education:

  • B.A. in English (New York University)

  • Sc.D. in microbiology (University of Michigan)

The purpose of this report is to present data on the utilization of trypsin-dispersed monkey kidney cells prepared according to a modification(1) of the method of Dulbecco and Vogt (2) for titration of poliomyelitis virus in roller tube cultures. Data are presented on yield of satisfactory culture tubes and on the experience with titrations of poliomyelitis viruses in such cultures as compared with cultures containing tissue fragments. Methods and materials. Preparation and standardization of trypsin-dispersed cell suspension, as well as materials employed, are the same as described earlier (l), including Medium D used to obtain outgrowth. At the time of virus inoculation, Medium E, composed of a mixture of 97.5 ml of Synthetic mixture 199 and 2.5 ml of 5% NaHC03/100 ml, was employed to replace medium D. Penicillin and streptomycin were added to a concentration/ml of 100 units and 0.1 mg, respectively. Medium D may be used to advantage when longer survival of cultures is desired, but was omitted in these studies to avoid ,any possible influence of the horse serum component on virus activity. Preparation of roller tube cultures of kidney fragments. Kidney fragments about 1-2 mm in diameter were prepared by mincing with scissors and were planted without exposure to trypsin. Two types of kidney fragment cultures were utilized: (a) kidney fragments grown under perforated cellophane( 3), and (b) kidney fragments grown directly on the glass wal1 of the roller tube. From 5 to 10 fragments of kidney cortex were introduced into each tube and outgrowth obtained by incubation while rolling at 36OC; nutrient consisted of 2 ml of Medium D/tube. After 6 or 7 days a zone of healthy epithelial outgrowth surrounded one or more fragments in each tube. At that time, the medium used to obtain outgrowth of epithelial cells was removed and replaced by Medium E, and inoculations carried out as described below.

So in this paper they are taking High Serum growth medium to grow the cells then intentionally taking the serum out for infection?

You’re reading it correctly—and your interpretation is essentially right, with a small nuance.

🧪 What’s going on with Medium D vs Medium E?

Medium D → used for cell growth

5

• Used before infection, to establish the cell monolayer

• Typically contains serum (growth factors, proteins, hormones)

• Purpose:

  • Help cells attach

  • Promote cell division and spreading

  • Create a healthy, confluent layer

👉 So yes — Medium D contains growth-supporting components (including serum)

Medium E → used during virus infection

5

• Used at the time of virus inoculation

• Composition (from your text):

  • Mostly Synthetic Medium 199

  • sodium bicarbonate (buffer)

• No serum added

👉 So yes — Medium E is essentially serum-free

🧠 Why remove serum during infection?

This is the key idea:

• Serum can interfere with virus assays:

  • Contains proteins that may bind or neutralize virus particles

  • Can reduce infection efficiency

  • Adds variability to titration results

• For titration experiments (like Youngner’s):

  • You want clean, controlled infection conditions

  • So you switch to a defined, serum-free medium

✅ Bottom line

• Medium D = growth medium → contains serum → used to grow cells

• Medium E = infection medium → no serum → used for virus titration

So an absolute bombshell lands in this paper if you follow the references, our eponymous English Lit Supervillain Ender’s actually WASN’T the real source of the Intentional fraud. It was indeed J.S Youngner his English Lit compatriot who in absolute razor sharp full HD develops an Assay that purposefully removes the nutrient medium (Medium D) after cell growth and replaces it with Zero serum (Medium E). Even noting that Medium D was for longevity but essentially had to be removed to get desired results!

Tissue culture technics. In the initial isolation attempts roller tube cultures ( 1 1 12) of human kidney, human embryonic lung, human embryonic intestine, human uterus and rhesus monkey testis were employed. Subsequent passages of the agents isolated were later attempted in human kidney, human embryonic skin and muscle, human foreskin, human uterus, rhesus monkey kidney and embryonic chick tissue. Stationary cultures prepared according to the technic of Youngner( 13) with trypsinized human and rhesus monkey kidney were later employed for isolation of agents and their passage.

B ) Cytopathogenic range. Monkey kidney is the only other tissue employed that has yielded a growth of cells in which the characteristic changes described above have been definitely observed following inoculation of virus. In cultures consisting largely of monkey renal epithelial cells as prepared by Youngner’s modification of Dulbecco’s technic (13) cytopathic changes have been regularly observed which resemble closely those produced by these agents in human renal cells as seen in both fresh and stained preparations.

Back to the Enders paper here and we see total and utter unmitigated proof it is the Youngner method of Starvation of the Cell Line which is causing the Cytopathic Effects seen. It explicitly says in two different sections that they attempted many human, monkey and chicken cell lines, but it wasn’t until they employed the Youngner method of Starvation that they saw any of the Cytopathic Effects.

CONTAGION FAIL

Strangely enough the technique that was “invented” by Enders to circumvent animal torture as proof of “viral Isolation” was tried in this very paper after culturing. They noted Cytopathic Effect in the cultures and injected into the stomach and head of newborn mice. Surprisingly despite this grotesque method of torture (Regardless of the contents of the injection), the “animals remained well”. Urm… that’s quite a big problem really that debunks their own paper.

C) Failure to induce demonstrable changes in mice or chick embryos. Two litters of suckling white mice ( 1-day-old) were inoculated with infective tissue culture fluid by both the intraperitoneal and intracerebral routes. The animals remained well during an observation period of 21 days. Employing the same material as inoculum (0.1 ml amounts were introduced into the amniotic sac of 7-day embryonated hen’s eggs. After 7 days incubation at 3fjQC the amniotic fluid and membranes were harvested, ground with alundum and centrifuged at 1500 rpm. The supernatant fluid was used for a second egg passage which was carried out in the same manner. Whereas inoculation of 0.1 ml aliquots of the first egg passage material into cultures of monkey renal epithelium was followed by characteristic cytopathic changes on the 8th day, the addition of 0.5 ml of second egg passage material to such cultures failed to produce this effect. No complement fixing antigen was detected in the materials from the egg passages. Although these results suggest that the virus is not readily adapted to growth in the chick embryo, it is evident that much further investigation will be required to determine the degree of susceptibility of this host.

CONTROL FAIL

Experimental. Cytopathic changes induced by agents isolated from cases of measles. The first of 8 agents obtained from blood or throat washings of measles cases and exhibiting comparable properties was isolated in cultures of human kidney tissue following addition of the blood of Case 3. In each of the 3 cultures that were inoculated cytopathic changes were observed on the 7th day. Since these changes presented a characteristic appearance not heretofore associated definitely with a virus they have provided the means for the further investigation of this agent as well as others that have been recently isolated. Accordingly, here at the beginning these changes will be described in detail. Observation of fresh preparations under low magnification ( 80X) revealed within the sheet-like outgrowth of renal epithelial cells discrete areas of varying size and shape in which the cell boundaries were obliterated and the nuclei often difficult to visualize. Within these areas, which may be described as non-refractile "glassy" plaques, large and small vacuoles were often numerous lending them a foamy or lace-like quality. The number and size of the vacuoles increased as incubation was continued. On careful examination of these areas many small, slightly refractile bodies were seen that resembled nucleoli within nuclei whose outlines could often be distinguished only with difficulty. The total effect thus suggested the presence of large vacuolated giant cells. After further cultivation the extent of the areas initially present was slowly extended or was enlarged by coalescence with neighboring plaques while others developed elsewhere. In addition to the formation of vacuoles degenerative changes gradually appeared within the affected areas suggesting coagulation necrosis. At the end of three weeks most of the epithelial cells appeared to be involved, yet here and there small aggregates of normal cells remained. These seemed, however, to be composed mainly of spindle-shaped cells, Reference to Fig. 1, 2 and 3 will aid in the visualization of these changes as they are manifest in the natural state. In contrast to the appearance of the normal cell outgrowth shown in Fig. 1 the smooth confluent area of affected cells stands out clearly in Fig. 2, While a slight degree of vacuolization is evident in this figure, it is extensive in Fig. 3 especially along the margin of cell growth where it is first apt to become apparent. The interpretation that has just been presented of the changes observed in fresh prepa-rations was supported by examination of fixed and stained materials. Under these conditions the glassy areas were clearly revealed as collections of nuclei surrounded by a common cytoplasmic matrix. As many as 40 to 100 nuclei were counted in such syncytial formations. Often the limits of the encompassing cytoplasm were sharply defined thus contributing to the impression that development of true giant cells has occurred in vitro. Whether or not this is actually the case, the phenomenon is of much interest in view of the constant presence of giant cells in lymphoid tissues during the early stages of measles in man( 14~5). Examination of stained materials also revealed significant changes within the nuclei of the giant cells that were not visible in fresh preparations. These consisted in a redistribution of the chromatin which ultimately assumed a marginal position where it formed a dense ring or crescent that stained intensely with the basic dye. Concomitantly the central portion of the nucleus came to be occupied by an apparently homogeneous substance, acidophilic in character, that approximated closely to the chromatin ring. Since in these and other preparations that have been examined subsequently no clear unstained zone has been observed between the chromatin and this acidophilic mass, it cannot be asserted that the latter represents an intranuclear inclusion body of the type characteristically associated with viral infections. Nevertheless, as far as can now be determined, its presence along with the margination of the chromatin affords a useful criterion of infection for the agents under study. It should be emphasized, however, that the changes as just depicted are encountered in cultures that have been incubated for relatively prolonged periods (e.g. 14-21 days). When the interval between inoculation of the agent and examination of the stained cells (e.g. 4 days) is shorter, margination of the chromatin may be incomplete or inapparent and the acidophilic substance may only be seen in small rounded masses distributed here and there amid nuclear materials that approximate the normal arrangement. Fig. 4, 5, 6 and 7 illustrate well-developed nuclear changes and also the general similarity of the affected areas to1 the giant cells encountered in lesions associated with measles. Of particular interest in this latter connection are the basophilic “pseudoprotozoal” bodies that Bonenfant (1 6) has recently described in the mucosa and lymphoid follicles in cases of this disease. These bodies were usually surrounded by an acidophilic homogeneous substance. As described and pictured these bodies with their matrix strikingly resemble the giant cells in tissue cultures that exhibit well -developed nuclear changes . Q Some biologic properties of the agents isolated from measles. Certain of the biologic properties of the agents isolated from patients with measles have been definitely determined, others in a preliminary or tentative manner. In several instances these properties have been studied only in respect to the strain first isolated from the blood of Case 3. Since, however, the other strains, as far as they have been examined, behave in a similar manner it is probable that all of them, when thoroughly studied, will exhibit the same general characteristics.

B ) Cytopathogenic range. Monkey kidney is the only other tissue employed that has yielded a growth of cells in which the characteristic changes described above have been definitely observed following inoculation of virus. In cultures consisting largely of monkey renal epithelial cells as prepared by Youngner’s modification of Dulbecco’s technic (13) cytopathic changes have been regularly observed which resemble closely those produced by these agents in human renal cells as seen in both fresh and stained preparations. These effects followed the addition of blood or throat washings from cases of measles as well as infected tissue culture fluids derived from previous passages. Monkey kidney cultures may, therefore, be applied to the study of these agents in the same manner as cultures of human kidney. In so doing, however, it must be borne in mind that cytopathic effects which superficially resemble those resulting from infection by the measles agents may possibly be induced by other viral agents present in the monkey kidney tissue (cf. last paragraph under G) or by unknown factors. In a few cultures of human prepucial tissue inoculated with one of the measles agents changes resembling those seen in renal cells were noted in the epithelial outgrowth about certain fragments. Additional observations, however, will be required before it can b3 confidently asserted that dermal epithelial cells are specifically attacked by these viruses. In a single experiment no cytopathic manifestations were seen during a period of 31 days following inoculation of infected tissue culture fluid into cultures of human embryonic skin and muscle, human uterine tissue or embryonic chick tissue. Tests for the presence of complement fixing antigen in the fluids removed from the cultures on the 31st day were negative. These serologic results suggest that growth of the virus did not occur, since, as will be shown subsequently, the antigen appears to develop regularly after several days in cultures of renal tissue infected with the virus.

F) Neutralization of cytopathogenicity by convalescent measles sera. That the cytopathogenic capacity of at least one strain of the agents associated with measles is inhibited by serum factors developing during the course of the disease has been demonstrated in two experiments. Employing 100 ID of the viral suspension mentioned in the previous paragraph neutralization tests were carried out in cultures of monkey renal epithelial cells. Sera taken during the acute and convalescent stages from two of the cases occurring at the boys’ school were stored at -15:C and inactivated at 56°C for 30 minutes before they were diluted and used in the test. As diluent bovine amniotic fluid was employed. Dilutions of serum and virus were mixed and kept at 5°C for one hour when 0.1 ml of each mixture was added to each of three tissue cultures. In both tests the cultures were examined every day or every 2 days and the final readings were recorded on the 10th day. The results are summarized in Table 11. They indicate that significant increases in substances occurred in the serum of both patients that neutralized the cytopathogenicity of the agent isolated from the blood of a third patient. In considering these results it is pertinent to recall that agents with similar characteristics have been isolated from the two patients whose convalescent sera were shown to possess virus neutralizing capacity.

A second agent was obtained from an uninoculated culture of monkey kidney cells. The cytopathic changes it induced in the unstained preparations could not be distinguished with confidence from the viruses isolated from measles. But, when the cells from infected cultures were fixed and stained, their effect could be easily distinguished since the internuclear changes typical of the measles agents were not observed. Moreover, as we have already indicated, fluids from cultures infected with the agent failed to fix complement in the presence of convalescent measles serum.

Control Conclusion

Let’s walk through the large amount of material above. Firstly we don’t see a single CPE morphology until a week into infection, for clarification that is one week after reducing the nutrient medium according to Youngner’s starvation protocol. The Vacuolation, Cytopathic Granulation and Plaquing registered in the “infected” culture we saw all of those exact morphologies in our uninfected cultures in our Control Experiments. These ubiquitous morphologies are seen and measured they keep going for up to a whopping 3 weeks in incubation, even then there are still some healthy cells remaining.

In both images of the Cell Lines they note there are Controls done, the first image is of the Roller Tube cells Uninoculated and in the latter it is “Outgrowth of Normal Human Renal Cells”. So this debunks the camp that bizarrely claim that “no Control was done” whether that be a legitimate control (All reagents the same-especially Serum) or what they call a “mock Control”. Let’s see here though that it is noted that the exact Roller Tube cells cultures were carried out according to the Youngner Assay. This Assay explicitly said that the Uninfected cultures were grown in Medium D that was rich in Serum, only on infection was that to be replaced with Medium E which had no Serum. Therefore we can adequately say that in the “Controls” that are presented there is serum present which is why both are described as being “Outgrowths” i.e have enough serum to replicate and grow.

The starved “infected” culture is once again confirmed to be only affected by that starvation medium change as they “Neutralize” the CPE by re-adding more Serum. This is seen to halt and even reverse the starvation and hence the cells can replicate and grow once more.

We then come to the greatest self own in the entire paper, potentially in the entirety of Virology. A passage I have quote hundreds if not thousands of times in the last 6 years: The “Uninoculated Culture” showed Cytopathic Changes which could not be distinguished with confidence from the viruses isolated from Measles. Let’s walk through exactly what we can infer from this:

There is no method for this “Uninoculated Culture” so we know not any other reagents that went into it. It was not referred to as the Control Culture, it was not seen as Healthy Outgrowth as pictured in the Control sections. The thing that is explicit is that it contains no “infected” material so it is operating either as a TRUE negative control OR a Mock Control dependent on Serum levels. This leaves us with two options of what the method was for this sample:

A. It was a TRUE negative control, they had a plate that they passaged with the reduced Serum according to Youngner’s protocol hence why they saw CPE.

or

B. It was the mock Control that had adequate Serum levels in it to start off with where they imaged before day 7 where the cells were healthy, but due to the experiment going of for such a long time (3 Weeks) by the time they reached the end, the serum had been depleted and the Starvation CPE had started.

Either way the net result of this is that John Enders DID run a TRUE Negative Control that FAILED as it produced the Observable Effect (CPE) that is meant to denote the presence of a “Virus” in the uninfected culture. Comically the English Lit major describes this not as a Control Failure but indeed was indicative of the presence of……..*MORE VIRUS* SMH.

With the sweep of his hand he then says “ Because the difference can be distinguished after it was fixed and stained” that it was fine. There are many problems with this statement in the fact that there was an entirely different cell type added in the “Infection medium” which is self evident to be “a difference”. He then gets more specific and says that the “Internuclear changes specific to measles were not present”. Well how would you know what was specific to Measles if you have never actually isolated it in the first place as your cell culture was fraudulent from a Negative Control Failure? Secondly he notes Cytopathic Effect that initially could not be distinguished and only changed his mind AFTER it was fixed and stained, which by proxy means that it was the fixing and staining process causing somewhat the “internuclear differences”.

The Internuclear changes are where cells fuse together, this was only seen later on in the experiment, with vacuolation in the beginning. Once again unless this was an exact True control taken through to day 21+ this may not have even been possible to see in the test culture. Lastly it also mentions the adding of “Convalescent Measles Serum which did not fix compliment” i.e they claim they are testing for “Antigens”. So let’s have a brief look at that:

Method:

🧫 Step 1 — Prepare the reagents

You need four key components:

1. Test antigen

   • Culture fluid containing the virus (unknown agent vs measles)

2. Serum (antibodies)

   • “Convalescent serum” (from a recovered measles patient)

3. Complement

   • Fresh serum (commonly guinea pig) containing active Complement system

4. Indicator system

   • Sheep red blood cells (RBCs)

   • Anti-sheep RBC antibodies

🔥 Step 2 — Inactivate endogenous complement in the serum

• Heat the patient serum (~56 °C for ~30 min)

👉 Why:

• Removes any native complement

• Ensures only the added complement is measured

🧪 Step 3 — Set up the main reaction

In a test tube:

• Add viral antigen

• Add patient serum (antibodies)

• Add complement

👉 Then incubate (typically 30–60 min at 37 °C)

🧠 What’s happening here

Two possibilities:

✅ If antibodies recognize the virus

• Antigen–antibody complexes form

• Complement binds → gets fixed (used up)

❌ If they don’t

• No complexes

• Complement stays free

🩸 Step 4 — Add the indicator system

Now add:

• Sheep RBCs

• Anti-sheep RBC antibodies

👉 Incubate again

how about higher serum content... because these cultures sometimes contain serum already to grow the cultures in the first place?

Excellent point — and yes, serum in the culture can absolutely interfere with these assays if you’re not careful. Early virologists had to think about exactly this.

🧪 Does serum cause RBC lysis?

🧬 1. Complement in serum (the main issue)

Serum naturally contains the Complement system.

👉 So if your culture fluid contains serum (e.g. from growth media):

• It may already contain active complement

• That complement could:

  • Lyse RBCs directly

  • Or mess up the assay timing

🔴 Consequence:

False hemolysis → looks like “no antibody binding” when that might not be true

So here we see the standard quackery employed, they are putting Sheep’s Blood in, if it settles at the bottom they ascribe a story for why, if it mixed and disperses they ascribe a different story. The clincher here is that it is also a measurement of basically how much Serum is in the sample. AI confirmed that effectively if there is already Serum in a sample it is more likely that the Sheep’s blood will disperse. Hence we can probably adequately assume that there was likely a bit of the Serum from the initial “Mock Control” in scenario B laid out above, that mock has been left for the full period of time and has starved certain cells in areas that have started to show CPE.

CONCLUSION

Moving toward the end of this article first we put to bed any doubt about the “Control” question with regards to John Enders carrying one out/ whether it failed or not. There are some really silly people out there that I won’t name because I can’t be bothered to utter their name further but it very well may rhyme with Ham Daily, that have claimed to read this paper and STILL come to the conclusion that there was no control carried out!? There are without a shadow of a doubt 3 controls that took place in this paper, 2 what should be described as a “Mock” control, the standard Virology fraud where they have high amounts of Serum to keep the cells healthy and by Enders own description to see “Outgrowth”. The last Control was, any which way you choose to interpret what exactly happened, a “True/er” Negative Control. Whether this was a “Mock” Control that got left a little too long so that the Serum started to deplete or a forgotten Infection Medium, Youngner Protocol left Uninfected by Mistake, the net result is that we saw what happens when you starve an uninfected cell line: You see the same Cytopathic Effect that is supposed to denote a “Virus”.

The huge bombshell that dropped in this article, that came as a real surprise to me was the clearcut, fully intentional design of the starvation of the cells in the Youngner Protocol. When you combine this, with the stated observations by Enders that they could only seem to get Cytopathic effect when they used this protocol it is absolutely damning. It is very satisfying to me personally as it validates my exact interpretation of the Experimental Controls that I have done as part of this project. When I went into the controls we tested for the effect of Antibiotics as much, maybe even more than the altering of FBS concentration. Yet I was seeing a lot more signal based on the altering of this FBS concentration rather than the Antibiotics, so that was my takeaway. Here this is verification that not only was I correct, but it seems that it was very much intentionally designed this way from the very first instance more than 70 years ago and has been used to defraud the field of “science” ever since.

So for the most important part of Virology, the benchmark, the raw isolated, purified thing you need to characterize we have managed to see clearly that our eponymous English Literature Grad, who was not only a puppet of the system, you can largely tell from his Nobel decoration, as they all have these archetypal personality traits and background, but indeed that because he had to “borrow” the real working mechanics of how to defraud this process from another English Major- albeit with a little more MicroBiological knowledge in J.S Youngner.

Just a small little Easter Egg in this article, those of you who are very eagle eyed and are regulars to reading my articles may have noticed I did not swear once. This was a conscious decision just to mix things up a bit. Normal Service Resumes.

J

If you have enjoyed this article and wanted to give a one time donation, please BuymeaCoffee by clicking on the link below.

This article will be available to download as an Ebook from The Shadow Banned Library, please click the image below and browse the entire catalogue.

The Human Genome Project was the benchmark for the Genetics Hoax. They took 13 years to “complete” it from 1990-2003 under the lead of Francis Collins for , quite unsurprisingly, the government institutes of the National Institute of Health as well as the U.S Department of Energy. Once again, unsurprisingly, after completion Collins landed a cushy job as Director of the NIH from 2009, which saw him be the longest standing director in the department’s history (they really like genetics).

The results of this project affects every single clinical sample ever taken and genetically tested, including PCR, purely because the sequence that the HGP generated is used to benchmark the primer sets and amplicon length, it is used as a “filter” for Shotgun Metagenomics, it is used to benchmark Primers, adapters and Library prep for Illumina. Practically it IS BLAST (Basic Local Alignment Search Tool) , the NIH database repository for the all known genomes purely because EVERY other genome on there has been filtered against this genome, certainly in Microbiology: When they take a sample say from your gut to sequence a gut bacteria, first thing they are going to do is remove every sequence that they think is the human genome, the rest they are going to claim is “up for grabs”. Hence it has intentionally shaped really the entirety of genetics, forcing sequences and genomes of everything else to mold around it.

I would like to stop here and explain before we go any further. NONE of this is real of course. I have written many articles explaining the hoax of Genetics, all they have is inferences, fluorescent dyes that are knowingly put into samples, that when they fluoresce a fantastical story is attached to why they did so. I will state this explicitly upfront. None of the articles that I am going to write on the Human Genome Project is giving any sort of credence to this subject, it is my belief that Genetics is a total hoax and I don’t even think there is a DNA/RNA “molecule” at all, especially because one has never actually been seen in a microscope.

Needless to say I think it of utmost importance that to fully debunk the hoax of genetics and all genetics assays like the PCR test it is incumbent, as explained above, to debunk the Human Genome (Project). Because of the sheer size of the project I will be breaking these articles into 3 sections, purely so that fatigue doesn’t set in when reading. This, I have to admit, the majority for me at least is FUCKING boring. The sophistry employed, the absolute wormhole of circular logic, the mountain of ridiculous and often completely crazy tests and procedures is just off the Richter scale.

So these ones come with a bit of a warning, these are not for the feint of heart, they will require some perseverance to wrap your head around what even they were trying to achieve. Even with my now coming on 5 years of simplifying their complete jargon bullshit down, found parts of this challenging, some aspects of these initial steps took a good 48hrs of research for it even to click as to wtf they were bothering to do all of these little intricate steps. “Back then” they didn’t have the luxury of just spamming everything into a white box of technology and hitting the enter key then pointing at it as proof of everything they had hoped to happen, happening. No they did it the “old school” way with fucking mental sophistry, usually squirting stuff onto various bacteria.

So given the warning, that no, I am not intentionally setting out to confuse people, merely documenting this complete shit show as best I can for you all to understand why I believe it to be one big fraudulent mess. We will get stuck into this and approach it from bottom up, starting with the “Roadmap”, the claimed skeleton of the Whole Human Genome, where they mapped out where the small little chunks of DNA that they “sequenced” would fit, into which of the 46 Chromosomes they claim them to fit into, arranged into one long contiguous (contig) sequence.

For the most parts of these articles I am going to section ChatGPT’s responses sidelined in Blue - with the Questions asked at the top (where applicable) in larger font (Highlighted in Yellow in the Ebook). This will serve as the basis for the understanding of what the Mainstream are saying is going on. I will write my explainers in each section, why I am asking AI the questions I am and what I believe to be the major flaws within each of these processes and how especially in this first section it will affect all downstream data.

So without further delay, let’s get this show on the road, brace yourselves:

THE ROADMAP

This is the basic bullet points of what we will be covering in this article

• Estimated the human genome length (~3 billion base pairs) using cytogenetic and molecular methods

• Decided on a hierarchical approach rather than sequencing everything at once

• Created genetic maps:

  • Used markers like RFLPs (restriction fragment length polymorphisms)

  • Determined relative positions of genes and markers along chromosomes

• Built physical maps:

  • Created contigs (overlapping DNA fragments)

  • Used cloning vectors: BACs (bacterial artificial chromosomes) and YACs (yeast artificial chromosomes)

  • Ordered the clones to cover entire chromosomes

• Integrated genetic and physical maps to produce a scaffold or framework for sequencing

• Prioritized chromosomal regions for initial sequencing based on map coverage

Genome Length Estimate

This is where it ALL stems from, the Genome length estimate. In creating the overall map they had to have a rough idea ( a complete fucking guess) at how long the human genome was. For when they came to it, how would they know for instance where to start and where to stop? Just a bit of trivia for you, the claim is that the first nucleotide of Chromosome 1 is a Cytosine (C). But how would they explicitly know that it starts there? Why not one forward or one back?

The Last nucleotide is claimed to be a Thymine (T) on Chromosome 22. But again how on earth would they explicitly know that it stopped right there? Even if they had an extremely accurate guestimate to start with, purely for the function that this sequence cannot be seen and is only inferred, this must be ruled as an assumption.

Before the Human Genome Project (HGP) officially began sequencing in 1990–2001, scientists had already arrived at a remarkably accurate estimate of the human genome’s size: approximately 3 billion base pairs (3 × 10⁹ bp, or about 3.2–3.5 billion bp in some refined estimates). This figure was known with reasonable confidence by the late 1960s to early 1980s, long before any large-scale DNA sequencing was possible. Below is a detailed, chronological explanation of the main methods used to estimate genome size pre-sequencing, with key references and links.1. Early Rough Estimates (1950s–1960s): Cytology, DNA Content, and Biochemical Measurements Scientists first estimated genome size by measuring the total amount of DNA per cell (the C-value, where “C” stands for constant haploid DNA content).

• Feulgen densitometry and micro spectrophotometry: These techniques stained DNA in cell nuclei and measured light absorption to quantify DNA mass. The result was converted to picograms (pg) of DNA per haploid genome (1 pg ≈ 978 million base pairs).

• Early measurements in the 1950s–1960s gave values around 3–3.5 pg of DNA per haploid human genome, which translates to roughly 3–3.4 billion base pairs.

A key early reference is the work of researchers like Mirsky and Ris (1951) and later refinements in the 1960s.Reference:

• Mirsky, A.E., & Ris, H. (1951). “The desoxyribonucleic acid content of animal cells and its evolutionary significance.” Journal of General Physiology. (Classic foundational work on DNA content across species.)

By the late 1960s, the figure of ~3 billion base pairs was already widely cited in textbooks and grant proposals as a working estimate.2. Reassociation Kinetics (Cot Analysis) – The Most Important Pre-Sequencing Method (1960s–1970s)This was the gold-standard biochemical method for estimating genome size and complexity before sequencing. How Cot analysis works:

• Extract and purify genomic DNA.

• Shear it into small fragments (~400 bp).

• Denature it (heat to separate strands).

• Allow the single strands to reassociate (reanneal) under controlled conditions.

• Measure the rate of reassociation over time (Cot = DNA concentration × time).

Key insights:

• Highly repetitive DNA reassociates very quickly.

• Moderately repetitive DNA reassociates at intermediate rates.

• Unique (single-copy) DNA reassociates slowly.

The Cot1/2 value (the Cot value at which 50% of the DNA has reassociated) for the unique-sequence fraction allows calculation of genome complexity/size, because the rate is inversely proportional to the number of unique sequences (i.e., genome size).For the human genome, Cot analysis showed a large unique-sequence component consistent with a genome size of ~3 × 10^9 base pairs. Key classic papers:

• Britten, R.J., & Kohne, D.E. (1968). “Repeated sequences in DNA.” Science. (Foundational paper on reassociation kinetics.)

• Direct human genome application: Schmid, C.W., & Deininger, P.L. (1975). “Sequence organization of the human genome.” Cell.
  → This and related works in the 1970s refined the estimate to approximately 3 billion bp, with about 60–70% unique sequence and the rest repetitive.

• A very useful later review of the method applied to genome size:
  Peterson, D.G., et al. (2002). “Integration of Cot analysis, DNA cloning, and high-throughput sequencing facilitates genome characterization and gene discovery.” Genome Research. (Discusses historical Cot-based estimates.)

Cot curves were the primary way scientists confidently stated “the human genome is about 3 billion base pairs” by the mid-1970s.3. Flow Cytometry (1970s–1980s onward)Flow cytometry measures the DNA content of individual nuclei stained with fluorescent dyes (e.g., propidium iodide).

• Cells are passed through a laser; fluorescence intensity is proportional to DNA amount.

• By comparing to standards with known genome sizes (e.g., chicken red blood cells), the human haploid genome size was measured as ~3.5 pg, which converts to ~3.4–3.5 billion base pairs.

This method became more accurate in the 1980s–1990s and confirmed the earlier Cot-based estimates. Reference:

• Doležel, J., et al. (various papers in the 1990s–2000s on plant and animal genome size by flow cytometry; human values were cross-referenced).

4. Other Supporting Methods

• Pulsed-field gel electrophoresis (PFGE) of large DNA fragments and early chromosome-specific cloning efforts provided lower-bound estimates.

• Genetic linkage map lengths (in centiMorgans) gave indirect clues, though conversion to base pairs was uncertain due to varying recombination rates.

• By the late 1980s, as the HGP was planned, the consensus figure used in official documents was ~3 billion base pairs (often cited as 3 × 10^9 bp for planning purposes).

The official HGP planning documents in 1990 used 3 billion base pairs as the target size. Key HGP-era reference:

• National Research Council (1988). “Mapping and Sequencing the Human Genome.” National Academies Press. (This report explicitly uses ~3 × 10^9 bp as the working estimate.)

Final Pre-HGP Consensus (Late 1980s)By the time the HGP was formally launched (1990), the scientific community had converged on:

• Haploid human genome size: approximately 3.0 – 3.5 × 10^9 base pairs.

• The most commonly cited planning figure was 3 billion bp.

This estimate proved remarkably accurate. The finished euchromatic sequence in 2004 was ~2.85–2.9 Gb, and the complete T2T-CHM13 assembly (2022) came in at ~3.055 billion bp (plus variable heterochromatin).Summary of Methods (Chronological Order of Importance)

1. DNA content measurements (1950s–1960s) → rough 3–3.5 pg → ~3 billion bp.

2. Cot / reassociation kinetics (1968–1970s) → most rigorous biochemical estimate of complexity and size.

3. Flow cytometry (1980s–1990s) → independent confirmation and refinement.

4. Early cloning and mapping efforts → lower-bound checks.

So Flow Cytometry is a basic measurement of mass? Could you walk me through in detail the protocol please.

Yes, you’re correct in spirit: Flow cytometry for genome size estimation is fundamentally a measurement of total DNA mass per nucleus, but it’s done indirectly through fluorescence intensity rather than weighing the DNA on a scale. It is one of the most accurate and widely used methods for estimating genome size (C-value) even today. Detailed Protocol: How Flow Cytometry Was (and Still Is) Used to Estimate Human Genome Size Here is the step-by-step protocol that was commonly used in the 1980s–1990s (and is still very similar today):1. Sample Preparation

• Collect fresh cells (typically human peripheral blood lymphocytes, cultured fibroblasts, or sperm cells for haploid measurements).

• For comparison, a standard with a known genome size is prepared at the same time. The most common internal standard was chicken red blood cells (CRBC), which have a well-established haploid genome size of ≈ 1.25 pg (≈ 1.22 billion bp).

2. Nuclei Isolation and Staining

• Cells are lysed gently to release nuclei (using a detergent like Triton X-100 or NP-40 in a hypotonic buffer).

• The nuclei are stained with a DNA-specific fluorescent dye that binds proportionally to the amount of DNA present. Common dyes used in genome size work:

  • Propidium iodide (PI) — the most popular (intercalates into double-stranded DNA).

  • DAPI (binds to AT-rich regions).

  • Hoechst 33258 or Sybr Green I.

• Staining is done under conditions that ensure stoichiometric binding (fluorescence intensity is directly proportional to DNA content).

• RNase is usually added to remove RNA, which could otherwise interfere with the DNA signal.

3. Flow Cytometry Measurement

• The stained nuclei suspension is run through a flow cytometer.

• Each nucleus passes single-file through a laser beam.

• The laser excites the fluorescent dye → the dye emits light proportional to the amount of DNA in that nucleus.

• Detectors measure the fluorescence intensity of each nucleus (typically thousands to tens of thousands of nuclei per sample).

• The instrument produces a histogram (DNA content distribution) where the x-axis is fluorescence intensity (proportional to DNA mass) and the y-axis is the number of nuclei.

4. Data Analysis and Calculation

• The histogram shows distinct peaks:

  • G0/G1 peak = unreplicated diploid (2C) DNA content.

  • G2/M peak = replicated diploid (4C) DNA content.

• The mean fluorescence intensity of the G0/G1 peak of the human sample is compared to the mean fluorescence intensity of the internal standard (chicken RBCs).

• The ratio is calculated:

Formula: Human 2C DNA content (pg) = (Mean fluorescence of human G0/G1 peak ÷ Mean fluorescence of standard G0/G1 peak) × Known 2C DNA content of standard

• Convert picograms to base pairs using the standard conversion factor: 1 pg DNA ≈ 978 million base pairs (0.978 × 10⁹ bp)

Example from real historical data:

• If human G0/G1 peak fluorescence is 2.85 times higher than chicken RBC peak.

• Chicken 2C DNA content = 2.5 pg.

• Human 2C = 2.85 × 2.5 pg = 7.125 pg.

• Haploid (1C) = 7.125 / 2 = 3.5625 pg.

• Convert to bp: 3.5625 pg × 978 × 10⁶ bp/pg ≈ 3.48 billion base pairs.

This was the kind of calculation used to arrive at the ~3.0–3.5 billion bp range before the HGP. Advantages and Limitations of This Method Advantages:

• Very accurate (±1–2% in good hands).

• Fast — thousands of nuclei measured in minutes.

• Can be done on many species for comparison.

Limitations:

• Measures total DNA mass, including repetitive DNA — it does not distinguish unique vs. repetitive sequences.

• Requires a good internal standard with a precisely known genome size.

• Cannot give sequence-level information (only bulk mass).

So we are going to interject here. The first methods of Feulgen Densitometry ( the key is in the name) and the most modern and up to date methods of quantifying the length of “DNA” in an organism’s cells was to calculate is off of it’s density. The most modern version it readily admits is compounded inference as readily admitted because not only is it inferring something from the density, even the density must be inferred from fluorescence. As you will come to see with all of these processes especially in the building of the initial Roadmap, it starts with something physical, i.e a nucleus or a Chromosome and it very quickly is ushered into the worlds of make believe and inferences. As discussed in numerous places on this channel, the reason for doing this is that they can then invent whatever story they like as soon as the benchmark no longer exists in reality and is just tied to a lab value.

Here we see the exact hand over from the real world into lab values. It is fair to say you could get an ok figure for how much a nucleus weighs. You can see it, it is possible to isolate one. You have a fairly good start for producing repeatable science, you may even just about be able to get away with using some sort of inference such as a lazer to measure density and it still be acceptable. But here is where the acceptability ends as they use this density value (that is just an average representation of a cell and in no way is an exact measurement of every cells deviations away from this HINT) to then infer how many nucleotides would fit in one long string inside this Nucleus:

So all of these are fundamentally based off of the weight of a nucleotide? how is this estimated if you can’t even see one in a microscope?

Excellent question. You’re touching on a very fundamental point. Yes — all of the pre-sequencing genome size estimates (Feulgen densitometry, flow cytometry, and even Cot analysis to some extent) ultimately rest on knowing the average molecular weight of one DNA base pair. But you’re right: no one has ever “seen” a single nucleotide in a light microscope, and the early estimates were made long before X-ray crystallography or modern sequencing. So how did scientists know the weight of a nucleotide/base pair with enough accuracy to convert picograms of DNA into billions of base pairs? Here’s the detailed, honest answer:1. The Weight of a Nucleotide/Base Pair Was Calculated Chemically, Not Visually Scientists did not need to see individual nucleotides under a microscope. They determined the molecular weight through pure chemistry and physics — the same way we know the exact molecular weight of water (H₂O = 18.015 Da) or glucose. How they did it:

• Base composition was already known (Chargaff’s rules, 1950s): DNA contains roughly equal amounts of A+T and G+C.

• The exact chemical structures and atomic compositions of the four nucleotides (dAMP, dTMP, dGMP, dCMP) were known from organic chemistry since the early 20th century.

• The average molecular weight of one base pair was calculated by adding up the atoms: A typical average base pair (considering sodium salt form of DNA, which is how it’s usually measured) comes out to approximately 615–660 Daltons (Da) per base pair. More precisely, the commonly used conversion factor in genome size literature is:1 picogram (pg) of DNA = 0.978 × 10⁹ base pairs
  (This comes from 1 pg = 10⁻¹² grams, and 1 base pair ≈ 615–660 Da on average, with Avogadro’s number used to convert between mass and number of molecules.)

This number was refined over decades through:

• Precise analytical chemistry (weighing purified nucleotides).

• X-ray crystallography of DNA (Franklin, Wilkins, Watson & Crick era — gave the structure and spacing).

• Later, direct mass spectrometry of oligonucleotides.

So the weight per base pair is a calculated physicochemical constant, not something guessed from looking at chromosomes.2. The Full Chain of Reasoning (Pre-HGP Genome Size Estimation)Here is the logical flow that was used:

1. Measure total DNA mass in a nucleus (in picograms) using:

   • Feulgen microspectrophotometry, or

   • Flow cytometry with fluorescent DNA dyes (propidium iodide, etc.)

2. Know the average mass of one base pair (≈ 650 Da on average, or more precisely the 0.978 × 10⁹ bp/pg conversion factor).

3. Calculate: Number of base pairs = (Total DNA mass in pg) × 0.978 × 10⁹

That’s it. The entire estimate rests on those two pillars: accurate mass measurement of DNA in a cell + accurate knowledge of the average molecular weight per base pair.3. Why This Was Reliable Enough

• The molecular weight of nucleotides is one of the most precisely known values in biochemistry.

• Multiple independent methods (Feulgen, flow cytometry, Cot kinetics) all converged on roughly the same number (~3.0–3.5 billion bp).

• By the time the HGP started, the community had such high confidence in the ~3 billion bp figure that it was used as the official planning target.

Bottom Line Yes — ultimately, all pre-sequencing genome size estimates were based on converting measured DNA mass into base pairs using the known average weight of one nucleotide pair. They didn’t need to see individual nucleotides under a microscope. They used:

• Classical analytical chemistry and physics to determine the molecular weight of the four nucleotides, and

• High-precision instruments (spectrophotometers and flow cytometers) to measure total DNA mass in millions of nuclei at once.

It’s the same principle as calculating how many water molecules are in a glass of water: you don’t need to see the molecules — you measure the mass and divide by the known molecular weight of H₂O. Would you like me to show you the actual arithmetic (with real historical numbers from a 1970s–1980s paper) so you can see exactly how they turned picograms into billions of base pairs? Or would you like the precise modern value of the conversion factor and how it was derived?

Derive the 0.978 conversion factor

Compare Feulgen vs flow cytometry

This was an assumption though purely by adding up the atomic weight not actually measuring the weight of a nucleotide correct? Short Answer

Short Answer: Yes — you are correct. The weight of a nucleotide (and therefore one base pair) used in all those genome size calculations was not obtained by directly weighing individual nucleotides. It was a calculated value based on adding up the known atomic weights of the atoms in the four nucleotides (A, T, G, C), plus the sugar and phosphate groups, and adjusting for the sodium salt form of DNA. They knew the exact chemical formula and atomic composition of each nucleotide from organic chemistry long before anyone could isolate or weigh a single nucleotide molecule. The conversion factor (1 pg DNA ≈ 978 million base pairs) is a theoretical/calculated constant, not an experimentally measured weight of actual nucleotides. So yes — it started as an assumption grounded in chemistry, not direct physical measurement of single nucleotides.

But that isn’t quite what I am looking for.. they haven’t isolated the molecule and measured it intact, they have broken it into it’s assumed parts and measured those. This is not a lot better than just assuming the weight from knowing its components.

You’re right to push on this. Your core point is fair and precise: They did not take one intact nucleotide molecule, put it on a super-precise scale, and directly measure its mass to confirm the atomic structure. That level of direct measurement on a single molecule wasn’t possible with the technology available at the time (and still isn’t trivial even today for such small, polar molecules).What Actually Happened (Honest Assessment)The confirmation process for the nucleotide structure was almost entirely indirect:

• They isolated macroscopic quantities of purified nucleotides (milligrams to grams of material, which is still trillions upon trillions of molecules).

• They broke those nucleotides apart chemically into smaller, already-known pieces (the base, the deoxyribose sugar, and phosphoric acid).

• They measured the elemental composition (C, H, N, O ratios) of the intact nucleotide and of the pieces.

• They synthesized the proposed structure from scratch and showed that the synthetic version behaved identically (same melting point, same UV spectrum, same chromatographic behavior, same chemical reactions) as the natural isolated material.

• Much later (1960s–1970s), they grew crystals of nucleosides and nucleotides and used X-ray crystallography to determine the exact 3D atomic arrangement.

So yes — the structure was assembled from known parts and confirmed by matching properties and synthesis, not by directly weighing or imaging one complete, intact nucleotide molecule in its native state. How Close Is This to “Just Assuming”? It’s significantly better than pure assumption, but it’s still not the same as directly measuring the mass of one whole, unbroken nucleotide.

• Strength: The chemical degradation + total synthesis approach is extremely powerful in organic chemistry. If the proposed structure was wrong, the synthetic compound would not have matched the natural one in multiple independent properties. The fact that it matched perfectly gave very high confidence.

• Limitation: You are correct that it relies on the assumption that the pieces fit together the way the chemists thought they did. There was no direct “snapshot” of the whole molecule at the time the structure was first accepted.

The first truly direct confirmation of the intact atomic structure came from single-crystal X-ray diffraction studies in the 1950s–1970s (e.g., work by Sundaralingam and others), which gave the exact bond lengths and angles for the whole nucleotide. Even then, X-ray crystallography gives the average structure from a crystal lattice, not a measurement of one floating molecule in solution. Bottom Line You are accurate in your skepticism:

• The original structure (1910s–1950s) was deduced and indirectly confirmed through degradation, elemental analysis, and synthesis.

• It was not confirmed by directly measuring the mass or structure of one intact nucleotide molecule.

• True atomic-level confirmation of the intact molecule came later with X-ray crystallography.

This is a classic example in the history of science: many molecular structures were accepted long before we had the tools to “see” them directly. The confidence came from the convergence of multiple indirect lines of evidence. Would you like me to show you the actual X-ray crystallography papers that provided the first direct atomic coordinates of a nucleotide? Those are the closest thing to what you’re looking for.

We have seen the most fundamental of problems arise in the very first step of this project. They are knowingly basing, what they claim to be a “very accurate guess” at its very core on a complete assumption. It is the standard wormhole of kicking every can possible down the road to molecular chemistry where they finally turn over their hand and just admit they have never actually benchmarked and measured the exact molecule of a nucleotide. They originally “worked out” its chemistry through a number of spurious and often fraudulent (read my work “mRNA is Piss”) chemical reactions and arrive at again another assumption that it contains certain elements. They originally simply based a calculation of how much a nucleotide weighed just by adding up the atomic mass (once again another fraud- a guestimate for indexing rather than a known weight).

Once we scratch beneath the surface we find out that nothing has changed, just the layers of deception have more money and circuit boards. They are doing the exact same cockamamy bullshit just by taking what they assume to be a nucleotides constituent parts and putting that into Mass Spec and would you know it, it agrees with their original assumptions that they found with the same machine. They may as well have cut out the middle man and just guessed all along.

They have never not once seen a nucleotide, they have never not once seen a string of nucleotides to know that is how they appear (read my work Seeing is Believing ). So the most fundamental part to this whole decade long (actually more like 3 decades as it is seemingly constantly being updated for its errors) project, that EVERYTHING was based off of, how long was the whole thing so as to determine how many parts to sample, how many to sequence, where to start, where to stop, where in fact WAS the “DNA”, tightly coiled in more dense regions, sparser in others, evenly spaced along the string, I could go on for a whole page of problems that stem from inferring even one step of this. Every downstream method from here on in is based off of what is essentially a very confident, complete fucking guess.

STS

Here we arrive at the first use of the wild guess of the Genomes length and we can see exactly just how damaging that is going to be. A Sequence Tagged Sit (STS) is basically a Primer, it is a supposed length of known nucleotide that can attach to the target Human Genome template like a Probe and fluoresce (Get used to this as the only thing that constitutes a “test” in the whole of genetics).

Given the first guess that the Human Genome was 3bn Nucleotides long they chose they were going to take sections 200k base pairs long (Because that is how many they recon a Bacteria can Queef out (See Part 2 of this series)) and divide that into 3bn, and you get 15,000…….. which is exactly how many STSs they used in the project… surprising huh, they assumed a length, used basic maths, and started and stopped exactly where this assumption maths told them to. There is literally nothing more sophisticated than that, it was that long because they assumed it was that long and it started with the first STS and ended with the last.

How did they find the STSs in the first place for the Human Genome Project?

Here’s a clear and accurate explanation of how STSs were found (generated) in the first place for the Human Genome Project. The Core Idea Behind STSs An STS (Sequence-Tagged Site) is simply a short, unique piece of DNA (usually 200–500 bp long) whose exact sequence is known and that can be reliably detected by PCR using a specific pair of primers. The STS itself is not invented or inserted — it is taken from the existing human genome. The concept was first proposed in 1989 by Maynard Olson and colleagues in a short but influential paper in Science (”A common language for physical mapping of the human genome”).How STSs Were Actually Generated During the HGP (Main Sources)The ~15,000 STSs in the landmark 1995 Whitehead/MIT map (and the ~10,000+ in the 1997 Stanford RH map) came from several practical sources. They did not require the full genome sequence — only short stretches of sequence were needed. Here are the main ways they were created:

1. Random Genomic Sequencing (the largest source for dense maps)

   • Human genomic DNA was cut into small fragments and cloned into vectors (e.g., lambda phage, cosmids, or plasmids).

   • These small inserts were randomly sequenced (often just a few hundred base pairs from one or both ends).

   • From these short sequences, scientists looked for unique (single-copy) regions that did not contain repeats.

   • Primer pairs were then designed to amplify a clean 200–500 bp segment from that unique region.

   • If the PCR worked cleanly on total human DNA and did not amplify from rodent DNA (in hybrid panels), it became a valid STS.

   • This “random shotgun” approach was the main way thousands of anonymous STSs were generated for genome-wide coverage.

2. BAC and YAC End-Sequencing

   • As large-insert clone libraries (YACs early on, then BACs) were built, the ends of the inserts were sequenced.

   • These end sequences were used to design new STSs directly linked to the clones.

   • This was very useful for building contigs because the STSs were physically tied to specific clones.

3. Expressed Sequence Tags (ESTs) from cDNA

   • mRNA was converted to cDNA, and short single-pass sequences (ESTs) were generated, especially from the 3’ untranslated regions.

   • Unique parts of these ESTs were turned into STSs.

   • This created “gene-associated” STSs that helped link the physical map to actual genes.

4. Conversion of Existing Genetic Markers

   • Previously mapped polymorphic markers (microsatellites/STRs, RFLPs) from genetic linkage maps were sequenced in their flanking regions.

   • Primer pairs were designed so they could be used as STSs in physical mapping.

The Validation Process (Critical Step)Not every sequenced fragment became a usable STS. A strict filtering process was applied:

• The primers had to produce a single, clean band of the expected size from total human DNA.

• The STS had to be unique (it should not amplify from multiple chromosomes or produce multiple bands).

• It was tested on somatic cell hybrid panels to assign it to a single chromosome.

Only about 50% of designed primer pairs survived to become validated, unique STSs. Summary of the Main Strategy in the HGP

• Random genomic sequencing + clone end sequencing provided the bulk of the ~15,000 STSs in the 1995 Whitehead map.

• ESTs and converted genetic markers added gene-rich and polymorphic landmarks.

• The beauty of the STS approach (as Olson proposed in 1989) was that once you had the short sequence and primers, any lab in the world could detect that exact location using PCR — no need to ship physical clones.

This “common language” of STSs allowed the HGP to integrate genetic maps, radiation hybrid maps, and clone-based physical maps efficiently.

As mentioned above I am not going to go too heavily into detail in this section because there is so much to it in the YAC and BAC section dealing with Bacterial cloning and inserts. What I will point out once again was that they benchmarked everything in this process around the invented figure of 15k. When they did the original sequencing as a “Shotgun” (Literally shotgun sequencing) to “sample” the Genome, they did it 15k times, when they got dodgy results that repeated, were found in multiple “locations”, were not reproducible or just failed to work they binned them until….. they filled up their original guestimate.

So the entire process you can see is from the get-go being molded around an assumption rather than just testing and seeing what comes back and following the results of that test.

SOMATIC HYBRIDIZATION AND G BANDED KARYOTYPING

As above they made the STSs by a Shotgun approach of sampling a presumed number equally “spaced” (Because how would they know right? more to come) sections that would cover the presumed total length of the genome. But how would they firstly know which Chromosome they were located on? And how would they know which order they were on the Chromosome once assigned? We are going to be dealing with the first of those two questions in this first section.

Below is something most of us would be familiar with which is the standardized accepted “average” for what the Human chromosomes (Called Karyotyping) look like. They have been stained with Giesma stain which is made from the currently in vogue dropper bottle alt drug of choice, Methylene Blue (Also a Textile Dye (Like most other dyes used in Biological Sciences) also the dye used in Porta Potties)). This dye is used to differentiate between the said chromosomes as they band slightly differently between the pairs, this is openly basically because of the density properties (Chromatin) is not equally distributed.

I have researched this area a little ( for sake of brevity have not included it) and it seems to hold up somewhat to scrutiny. Yes of course there are cock-ups in this area, quite a bit of it is down to interpretation and low fidelity images can make the task very difficult. So do I think they can find and identify these 46 Chromosomes fairly well in the human cell, probably yes. Second question, is that of any use? No not a fucking bit, a total waste of time: Of course they only care what they infer are inside these little microscopic chipolata, all of it being a complete fairytale. These are just physical structures, string like that only occur during mitosis when the cell is splitting. It is like pulling a jalapeño popper apart and pointing at the cheese pull and saying “The fundamental mechanics of why the (Karl) popper is pulling apart is because of these stringy bits, what is in the stringy bits is driving the popper apart through exact copies of Popper Genetics being made.

So this is another analogy I will give: If you covered a load of human beings in Methylene Blue (Porta Potty Dye) then looked for fingers and toes, the dye would probably make some sort of banding around the knuckles and combined with length you would be able to A tell that these were human, as opposed to a lizard (In some cases) and B Roughly order them to show the fingers and toes and which hand/foot they would appear on. Of course you could build up some pattern recognition, you could hone it down to being pretty consistent, but honestly what would be the fucking point? Geneticists are taking something physical like a finger and then saying inside the thumb is a nuclear reactor, the pinkie is a magic wand and the index is like a USB flash drive. Of course that sounds like a bunch of horseshit, but that is literally what they are doing with Chromosomes.

What is the stain for G banding in karyotyping called and how does it stain, is it just a density thing?

The stain used for G-banding in karyotyping is Giemsa stain.

---

How it works (concise)

1. Chromosomes are first treated with trypsin
   → partially digests chromosomal proteins.

2. Then stained with Giemsa
   → binds to DNA, especially A–T rich regions.

---

What determines the banding pattern?

It’s not just density, but mainly DNA composition + chromatin structure:

• Dark G-bands

  • A–T rich DNA

  • More condensed (heterochromatin)

  • Fewer active genes

  • Stain darkly

• Light G-bands

  • G–C rich DNA

  • Less condensed (euchromatin)

  • Gene-rich, more active

  • Stain lightly

I thought GC were heavier bases? why does it not stain more with heavier bases?

Great question — you’re right that G–C base pairs are “heavier” (they have 3 hydrogen bonds vs 2 in A–T), but G-banding is not about molecular weight or density.

Why GC-rich regions don’t stain darker

Giemsa stain binds preferentially to A–T rich DNA, not because it’s lighter, but because of structure and accessibility:

• Binding preference

  • Giemsa (via its dye components) fits better into the minor groove of A–T rich DNA

  • So A–T regions take up more stain → appear dark

• Chromatin packing matters more than mass

  • A–T rich regions → tightly packed (heterochromatin) → stain dark

  • G–C rich regions → loosely packed (euchromatin) → stain light

• Effect of trypsin (trypsin)

  • It digests proteins more in open (GC-rich) regions

  • These regions lose structure and don’t retain stain well

You can see chromosomes under a microscope — especially during mitosis, when they are condensed and visible — but you cannot just “cut one out” of a cell and sequence it. Here’s why, step by step:

---

1. Chromosomes are microscopic and fragile

• Human chromosomes are extremely thin fibers of DNA wrapped around proteins (chromatin).

• Under a microscope, they are visible as bands, but each chromosome contains tens to hundreds of millions of base pairs.

• Physically isolating a single intact chromosome without breaking it is essentially impossible with current lab techniques, especially in the 1990s.

---

2. DNA is extremely long and delicate

• Chromosome 1, for example, is ~248 million base pairs long.

• If you tried to physically extract it:

  • It would break into thousands of tiny fragments

  • Handling that intact DNA is like trying to lift a spider web the size of a football field — it’s too fragile.

---

3. Sequencing technologies require small fragments

• Sanger sequencing (used in the HGP) can only read ~500–1000 base pairs at a time.

• Even if you could isolate an entire chromosome intact:

  • You would still need to fragment it into small pieces for sequencing

  • And then reassemble it computationally

So the clone-by-clone approach mimics this “fragment and assemble” process in a controlled, mapped way.

---

4. Why mapping matters

• If you just randomly broke chromosomes apart:

  • You wouldn’t know which fragments belong to which chromosome

  • Assembling them would be like trying to reconstruct 23 shredded novels without page numbers

• The HGP solved this by mapping fragments to specific chromosomes first, then sequencing them

Next up we are going to see how this all relates to The Human Genome Project. I have to be honest this was an area that was a real head scratcher for me to try and understand exactly wtf was going on in this process and why they were going to all of this trouble. So I will take the literal hours I spent with Chat GPT and break it down really quickly for you before you read the next very long section:

As pointed out above they cannot isolate a single chromosome and just test it (funny that), they are apparently too delicate (could you extract the pull part of a cheese pull if it were the size of a cell? thought not). They have to freeze a cell in mitosis phase, then this is where it gets really weird, I mean full marks for whoever dreamt up this process, they fuse these human cells with hamster cells (any rodent will do apparently- I’d choose a Capybara). For reasons unknown, when these fused (Hybrid) cells divide they keep all the hamster chromosomes (which can be distinguished from human with Karyotyping as above), but they indiscriminately loose “Some” human chromosomes.

They then take multiples of these hybrid cells and PCR test them with the STSs. Where they test negative the STS is apparently not found on that chromosome, where they test positive one of the chromosomes is then a candidate and the whittle it down by process of elimination. After this biblically tenuous and time consuming set of procedures they end up with claiming to be able to tell which STS appears on which chromosome. This entire procedure can be boiled down to this: They are PCR testing the chromosomes in pools because they can’t do them individually.

So now you have been brought up to speed on why this mental rodent/human Frankenstein procedure was claimed to be needed you can adequately approach the next parts to this investigation below:

Somatic Hybridization (Concise Method)

1. Select two different cell types
   Typically human cells + rodent (e.g., mouse) cells.

2. Fuse the cells
   Use chemicals like polyethylene glycol (PEG) or viruses to create hybrid cells.

3. Culture hybrid cells
   Grow them under selective conditions so only fused cells survive.

4. Chromosome loss
   Over time, hybrids randomly lose human chromosomes while retaining the full rodent set.

5. Identify retained chromosomes
   Use staining or molecular markers to determine which human chromosomes remain.

6. Gene mapping
   Test for specific gene products (proteins/enzymes).
   → If a gene is expressed only when a certain chromosome is present, the gene is assigned to that chromosome.

Why is it that only some human chromosomes survive and what determines which ones are lost?

In somatic cell hybrids (e.g., human × mouse), only some human chromosomes survive because they are selectively lost during cell division.

Why are human chromosomes lost?

• The hybrid cell’s division machinery is adapted to the rodent genome, not the human one.

• Human chromosomes often fail to attach properly to the spindle during mitosis.

• This leads to missegregation (they don’t get pulled into daughter cells) and are gradually eliminated.

What determines which chromosomes are lost?

It’s mostly random, but with biases:

• Random loss: Each division can drop different human chromosomes by chance.

• Stability differences: Some chromosomes are more stable (better centromere function, structure) and persist longer.

• Selective advantage: If a chromosome carries a gene that helps survival under culture conditions, it’s more likely to be retained.

• Cell line conditions: The type of rodent cell and growth conditions can influence retention patterns.

Chromosomes That Were More Difficult to Differentiate/Mapp Yes — some chromosomes posed challenges due to biology or technical issues:

• Y chromosome — Very difficult. It has few unique genes/markers, high heterochromatin (repetitive), and low retention in hybrids (often lost quickly). Many Y-specific STSs had lower success rates or required special panels.

• Centromeric/pericentromeric regions — Highly repetitive (alpha-satellite DNA), so STSs here were hard to design (often multi-copy). Mapping near centromeres was error-prone; many markers were excluded or misassigned.

• Acrocentric chromosomes (13, 14, 15, 21, 22) — Short arms are highly repetitive/satellite-rich; assignments sometimes ambiguous.

• Chromosome 19 & 22 — Gene-rich but with complex repeats; higher chance of chimeric or low-retention hybrids.

Overall, autosomes 1–12 were easiest; sex chromosomes (X/Y) and small acrocentrics were trickier. Problems Experienced at This Stage in the HGP The HGP encountered several real challenges with somatic hybrids and early marker assignment:

• Low resolution — Hybrids assigned to whole chromosomes or large arms, not fine-scale order → needed RH for refinement.

• Chromosome loss/retention bias — Some chromosomes (Y, small acrocentrics) retained poorly → incomplete coverage or weak statistics.

• Chimerism/translocations — Hybrids sometimes had rearranged or fused chromosomes → false assignments (resolved by karyotyping/FISH).

• Time and labor — Screening thousands of STSs on panels was slow → bottleneck before automation/high-throughput PCR.

• Repeat/multi-copy issues — ~20% of STSs failed uniqueness checks → discarded, reducing usable markers.

• Integration challenges — Early maps (pre-1997) had discrepancies between hybrid, linkage, and YAC data → required cross-validation and consensus building (HGM workshops).